Incidental Mutation 'R9459:Vmn1r1'
ID 714737
Institutional Source Beutler Lab
Gene Symbol Vmn1r1
Ensembl Gene ENSMUSG00000091013
Gene Name vomeronasal 1 receptor 1
Synonyms Gm6628
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 182154704-182164486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 182157938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000133035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169123] [ENSMUST00000227586] [ENSMUST00000227629]
AlphaFold E9PVR6
Predicted Effect probably benign
Transcript: ENSMUST00000169123
AA Change: V54A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133035
Gene: ENSMUSG00000091013
AA Change: V54A

DomainStartEndE-ValueType
Pfam:V1R 38 301 8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227586
AA Change: V54A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000227629
AA Change: V54A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Vmn1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0535:Vmn1r1 UTSW 1 182157951 missense probably benign 0.00
R1330:Vmn1r1 UTSW 1 182158007 missense probably damaging 1.00
R1696:Vmn1r1 UTSW 1 182158059 missense probably benign 0.26
R1809:Vmn1r1 UTSW 1 182157806 missense possibly damaging 0.82
R4661:Vmn1r1 UTSW 1 182157224 missense possibly damaging 0.90
R4717:Vmn1r1 UTSW 1 182157209 missense possibly damaging 0.66
R4765:Vmn1r1 UTSW 1 182157906 missense probably benign 0.00
R4772:Vmn1r1 UTSW 1 182157546 missense probably benign 0.41
R4864:Vmn1r1 UTSW 1 182157767 missense probably benign
R5369:Vmn1r1 UTSW 1 182157776 missense possibly damaging 0.87
R5594:Vmn1r1 UTSW 1 182157407 missense probably damaging 1.00
R6240:Vmn1r1 UTSW 1 182157621 missense probably damaging 1.00
R6667:Vmn1r1 UTSW 1 182157777 missense probably benign 0.22
R7075:Vmn1r1 UTSW 1 182158032 missense probably benign 0.00
R7686:Vmn1r1 UTSW 1 182158025 missense probably damaging 1.00
R7908:Vmn1r1 UTSW 1 182157350 missense probably benign 0.45
R8514:Vmn1r1 UTSW 1 182157573 missense probably benign 0.04
R8951:Vmn1r1 UTSW 1 182157744 missense probably damaging 1.00
R9332:Vmn1r1 UTSW 1 182157437 missense probably damaging 1.00
R9450:Vmn1r1 UTSW 1 182157205 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACAGGAACTTCTGGGGCTG -3'
(R):5'- GCATTGCTTTCAGATGTGTCC -3'

Sequencing Primer
(F):5'- AACTTCTGGGGCTGAGGAG -3'
(R):5'- GTGTGTTCCTTTCCCCCATAAGATG -3'
Posted On 2022-06-15