Mutagenetix > Incidental Mutation

Incidental Mutation 'R9459:Zfp804a'

714740

Institutional Source

Beutler Lab

Gene Symbol

Zfp804a

Ensembl Gene

ENSMUSG00000070866

Gene Name

zinc finger protein 804A

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R9459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82053222-82259879 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82259409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1194 (I1194T)

Ref Sequence

ENSEMBL: ENSMUSP00000041941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047527]

AlphaFold

A2AKY4

Predicted Effect

probably damaging
Transcript: ENSMUST00000047527
AA Change: I1194T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: I1194T

Domain	Start	End	E-Value	Type
ZnF_C2H2	57	81	7.29e0	SMART
low complexity region	588	595	N/A	INTRINSIC
low complexity region	801	808	N/A	INTRINSIC
low complexity region	1012	1029	N/A	INTRINSIC
low complexity region	1061	1077	N/A	INTRINSIC
low complexity region	1168	1191	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	T	A	19: 5,503,729	H8L	probably benign	Het
Abcb1a	T	A	5: 8,685,414		probably null	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Aox3	A	G	1: 58,150,309	I390V	probably benign	Het
Ap3b2	T	C	7: 81,473,903	N400S	probably benign	Het
Baalc	A	T	15: 38,934,024	N70I	probably benign	Het
Brca2	T	A	5: 150,540,629	V1286D	probably damaging	Het
Ccdc30	T	C	4: 119,377,273	R81G	possibly damaging	Het
Cd209g	T	C	8: 4,135,610	S15P	probably benign	Het
Chrnb3	G	A	8: 27,393,856	W207*	probably null	Het
Cmpk2	C	T	12: 26,478,023	T413M	probably damaging	Het
Coq4	T	A	2: 29,788,550	Y63N	probably damaging	Het
Depdc5	T	A	5: 32,990,773	S1478T	probably damaging	Het
Etf1	A	G	18: 34,906,081	F378L	probably benign	Het
Exoc6	T	C	19: 37,585,893	V324A	probably benign	Het
Frem2	A	G	3: 53,653,486	L1200P	probably benign	Het
Gadl1	T	C	9: 115,965,611	W285R	probably damaging	Het
Gbp3	A	G	3: 142,564,946		probably null	Het
Gm14295	C	T	2: 176,807,372	T5I	possibly damaging	Het
Hps4	T	C	5: 112,375,009	S578P	probably benign	Het
Kctd13	T	A	7: 126,945,082	D317E	probably damaging	Het
Kdm4b	T	A	17: 56,399,509	D881E	probably benign	Het
Klf10	G	A	15: 38,295,927	P473L	probably damaging	Het
Lrch3	A	T	16: 32,979,405	D371V	probably damaging	Het
Msh2	T	C	17: 87,678,330	S112P	possibly damaging	Het
Msh3	A	G	13: 92,215,539	V1036A	possibly damaging	Het
Mybl1	A	G	1: 9,676,259	V392A	possibly damaging	Het
Myo7a	T	C	7: 98,073,173	I1182V	possibly damaging	Het
Nectin1	A	C	9: 43,803,793	E442A	probably benign	Het
Obsl1	G	T	1: 75,498,240	H839N	probably benign	Het
Olfr1202	T	C	2: 88,817,623	F151L	probably benign	Het
Olfr1505	T	C	19: 13,919,310	C97R	possibly damaging	Het
Pacs1	C	T	19: 5,145,070		probably null	Het
Pcdh17	G	T	14: 84,448,623	E843D	probably benign	Het
Pcnt	A	G	10: 76,392,738	L1531P	probably damaging	Het
Pdgfra	A	G	5: 75,192,468	D973G	probably damaging	Het
Pkd2	A	G	5: 104,466,934	Y214C	probably damaging	Het
Plcb1	T	C	2: 135,322,638	Y427H	probably benign	Het
Ppm1h	A	G	10: 122,907,577	N402S	possibly damaging	Het
Rassf4	T	A	6: 116,641,788		probably null	Het
Ryr1	G	A	7: 29,068,643	T2856I	probably damaging	Het
Serpinb8	A	T	1: 107,605,790	K192*	probably null	Het
Slfn14	T	G	11: 83,279,372	Q482P	possibly damaging	Het
Spata2	A	G	2: 167,485,285	V64A	probably benign	Het
Tax1bp1	T	G	6: 52,729,329	V105G	probably damaging	Het
Tbc1d22a	T	G	15: 86,235,820	S142A	possibly damaging	Het
Tdrd9	T	C	12: 112,025,573	F594S	probably damaging	Het
Uba3	T	C	6: 97,189,598	I281V	probably benign	Het
Uggt2	T	C	14: 119,049,183	E723G	probably benign	Het
Usp20	C	T	2: 31,011,012	S391F	probably damaging	Het
Usp24	T	A	4: 106,342,358	D166E	probably damaging	Het
Vmn1r1	A	G	1: 182,157,938	V54A	probably benign	Het
Zfp442	T	A	2: 150,408,748	E411D	unknown	Het

Other mutations in Zfp804a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Zfp804a	APN	2	82053875	missense	probably benign	0.30
IGL02011:Zfp804a	APN	2	82256691	missense	probably damaging	1.00
IGL02218:Zfp804a	APN	2	82259202	missense	probably damaging	1.00
IGL02645:Zfp804a	APN	2	82053876	missense	possibly damaging	0.94
PIT4431001:Zfp804a	UTSW	2	82259192	missense	probably benign	0.04
R0027:Zfp804a	UTSW	2	82257200	missense	probably damaging	1.00
R0167:Zfp804a	UTSW	2	82256516	missense	probably damaging	1.00
R0437:Zfp804a	UTSW	2	82053791	start codon destroyed	probably null	0.08
R0521:Zfp804a	UTSW	2	82259417	nonsense	probably null
R0546:Zfp804a	UTSW	2	82258920	missense	possibly damaging	0.91
R0609:Zfp804a	UTSW	2	82257588	missense	probably damaging	1.00
R0694:Zfp804a	UTSW	2	82053804	missense	probably damaging	1.00
R0837:Zfp804a	UTSW	2	82259162	missense	probably damaging	1.00
R0947:Zfp804a	UTSW	2	82258718	missense	possibly damaging	0.58
R1103:Zfp804a	UTSW	2	82257500	missense	probably damaging	0.99
R1168:Zfp804a	UTSW	2	82256697	missense	probably benign	0.43
R1365:Zfp804a	UTSW	2	82257246	missense	probably benign	0.00
R1377:Zfp804a	UTSW	2	82258497	missense	probably benign	0.39
R1501:Zfp804a	UTSW	2	82235799	missense	probably damaging	1.00
R1526:Zfp804a	UTSW	2	82258188	missense	probably benign
R1585:Zfp804a	UTSW	2	82053751	start gained	probably benign
R1674:Zfp804a	UTSW	2	82258824	missense	probably benign	0.35
R2058:Zfp804a	UTSW	2	82257366	missense	probably benign	0.00
R2146:Zfp804a	UTSW	2	82258664	missense	probably benign	0.02
R2149:Zfp804a	UTSW	2	82258664	missense	probably benign	0.02
R2171:Zfp804a	UTSW	2	82257183	missense	possibly damaging	0.77
R2307:Zfp804a	UTSW	2	82256857	missense	probably benign	0.04
R2398:Zfp804a	UTSW	2	82258669	missense	possibly damaging	0.95
R2496:Zfp804a	UTSW	2	82235844	missense	probably damaging	1.00
R2504:Zfp804a	UTSW	2	82257519	missense	probably benign	0.00
R2919:Zfp804a	UTSW	2	82235816	missense	probably damaging	1.00
R2943:Zfp804a	UTSW	2	82235879	missense	probably damaging	1.00
R3116:Zfp804a	UTSW	2	82259417	missense	probably damaging	1.00
R4170:Zfp804a	UTSW	2	82253488	missense	probably damaging	1.00
R4393:Zfp804a	UTSW	2	82256921	missense	probably benign	0.43
R4701:Zfp804a	UTSW	2	82256582	missense	probably damaging	1.00
R4771:Zfp804a	UTSW	2	82257942	missense	probably benign	0.01
R4793:Zfp804a	UTSW	2	82235842	missense	probably damaging	1.00
R5523:Zfp804a	UTSW	2	82258995	missense	probably damaging	1.00
R5526:Zfp804a	UTSW	2	82258590	missense	probably benign	0.00
R5961:Zfp804a	UTSW	2	82258002	missense	probably benign
R6181:Zfp804a	UTSW	2	82257142	missense	probably damaging	1.00
R6209:Zfp804a	UTSW	2	82258118	missense	probably damaging	1.00
R6325:Zfp804a	UTSW	2	82257038	missense	possibly damaging	0.80
R7147:Zfp804a	UTSW	2	82258187	missense	probably benign	0.00
R7229:Zfp804a	UTSW	2	82258625	missense	probably benign	0.04
R7666:Zfp804a	UTSW	2	82259060	nonsense	probably null
R7910:Zfp804a	UTSW	2	82256573	missense	probably damaging	1.00
R8256:Zfp804a	UTSW	2	82053849	missense	probably damaging	0.99
R8669:Zfp804a	UTSW	2	82257762	missense	probably damaging	1.00
R8738:Zfp804a	UTSW	2	82259106	missense	probably damaging	1.00
R8749:Zfp804a	UTSW	2	82257575	missense	probably benign	0.18
R8751:Zfp804a	UTSW	2	82235846	missense	probably damaging	0.96
R8828:Zfp804a	UTSW	2	82259115	missense	possibly damaging	0.74
R8834:Zfp804a	UTSW	2	82259097	missense	possibly damaging	0.76
R8924:Zfp804a	UTSW	2	82258403	missense	probably benign	0.03
R8982:Zfp804a	UTSW	2	82235828	missense	probably damaging	1.00
R9570:Zfp804a	UTSW	2	82258500	missense	probably benign	0.22
X0064:Zfp804a	UTSW	2	82235823	missense	probably damaging	1.00
Z1177:Zfp804a	UTSW	2	82258563	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GAACATCTATACCTCAGATCTCCGTAG -3'
(R):5'- GGGTCATCAGCTTTGTCTAAAC -3'

Sequencing Primer
(F):5'- AGGAACTGTAGGACCTAGGCTTTG -3'
(R):5'- GCTTTGTCTAAACATTAAATAGGTGC -3'

Posted On

2022-06-15