Incidental Mutation 'R9459:Olfr1202'
ID 714741
Institutional Source Beutler Lab
Gene Symbol Olfr1202
Ensembl Gene ENSMUSG00000064084
Gene Name olfactory receptor 1202
Synonyms MOR232-7, GA_x6K02T2Q125-50290367-50291296
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 88814496-88820711 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88817623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 151 (F151L)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
AlphaFold Q8VF98
Predicted Effect probably benign
Transcript: ENSMUST00000072057
AA Change: F151L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: F151L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214703
AA Change: F151L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000217059
AA Change: F151L

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Olfr1202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Olfr1202 APN 2 88817437 missense possibly damaging 0.54
R0105:Olfr1202 UTSW 2 88817909 missense probably damaging 1.00
R0699:Olfr1202 UTSW 2 88817224 missense probably damaging 1.00
R0709:Olfr1202 UTSW 2 88817882 missense probably benign 0.42
R1177:Olfr1202 UTSW 2 88817360 missense probably benign 0.06
R1436:Olfr1202 UTSW 2 88817992 missense possibly damaging 0.48
R1827:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1828:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1872:Olfr1202 UTSW 2 88817936 missense probably benign 0.02
R1878:Olfr1202 UTSW 2 88817461 missense probably benign 0.00
R4903:Olfr1202 UTSW 2 88817998 missense probably benign 0.14
R5035:Olfr1202 UTSW 2 88818099 missense probably benign 0.01
R6279:Olfr1202 UTSW 2 88817375 missense probably damaging 1.00
R7402:Olfr1202 UTSW 2 88817343 missense probably damaging 1.00
R7809:Olfr1202 UTSW 2 88817558 missense probably damaging 0.96
R8172:Olfr1202 UTSW 2 88817642 missense probably damaging 1.00
R8193:Olfr1202 UTSW 2 88817459 missense probably damaging 1.00
R8673:Olfr1202 UTSW 2 88817246 missense probably benign
R8730:Olfr1202 UTSW 2 88817699 missense possibly damaging 0.64
R9772:Olfr1202 UTSW 2 88817614 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAATGGATGCATGACCCAAG -3'
(R):5'- TCCTTAGGGAGTTAAGAATGACC -3'

Sequencing Primer
(F):5'- GCATGACCCAAGTTTTTGCAG -3'
(R):5'- TTAGGGAGTTAAGAATGACCAGGTAG -3'
Posted On 2022-06-15