Incidental Mutation 'R9459:Zfp442'
ID 714743
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9459 (G1)
Quality Score 144.008
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150408748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 411 (E411D)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect unknown
Transcript: ENSMUST00000109916
AA Change: E411D
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: E411D

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCACATTGCTCACATTCAT -3'
(R):5'- AAGCAATGTGGTAAATCCTTTGCA -3'

Sequencing Primer
(F):5'- ACATTGCTCACATTCATAGGGTTTC -3'
(R):5'- GCTGTCATCTTCGAAGGCATCAAAG -3'
Posted On 2022-06-15