Incidental Mutation 'R9459:Zfp442'
ID 714743
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9459 (G1)
Quality Score 144.008
Status Not validated
Chromosome 2
Chromosomal Location 150249061-150293406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150250668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 411 (E411D)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect unknown
Transcript: ENSMUST00000109916
AA Change: E411D
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: E411D

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150,251,267 (GRCm39) nonsense probably null
IGL02566:Zfp442 APN 2 150,251,711 (GRCm39) critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150,251,714 (GRCm39) splice site probably benign
LCD18:Zfp442 UTSW 2 150,261,768 (GRCm39) intron probably benign
PIT4812001:Zfp442 UTSW 2 150,251,661 (GRCm39) nonsense probably null
R0219:Zfp442 UTSW 2 150,253,160 (GRCm39) missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150,253,169 (GRCm39) missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150,250,260 (GRCm39) nonsense probably null
R1702:Zfp442 UTSW 2 150,251,100 (GRCm39) nonsense probably null
R1829:Zfp442 UTSW 2 150,250,983 (GRCm39) missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150,250,100 (GRCm39) missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150,250,582 (GRCm39) missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150,250,042 (GRCm39) missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150,251,526 (GRCm39) missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150,250,149 (GRCm39) missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150,253,130 (GRCm39) critical splice donor site probably null
R4932:Zfp442 UTSW 2 150,251,635 (GRCm39) missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150,250,415 (GRCm39) missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150,251,530 (GRCm39) missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150,250,079 (GRCm39) missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150,249,944 (GRCm39) nonsense probably null
R6042:Zfp442 UTSW 2 150,250,016 (GRCm39) missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150,293,321 (GRCm39) critical splice donor site probably null
R6452:Zfp442 UTSW 2 150,250,028 (GRCm39) missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150,251,499 (GRCm39) missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150,252,860 (GRCm39) critical splice donor site probably null
R7061:Zfp442 UTSW 2 150,249,937 (GRCm39) missense probably benign 0.33
R7184:Zfp442 UTSW 2 150,250,056 (GRCm39) missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150,251,201 (GRCm39) missense probably benign 0.04
R7225:Zfp442 UTSW 2 150,250,925 (GRCm39) missense probably benign 0.00
R7513:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R7591:Zfp442 UTSW 2 150,250,092 (GRCm39) nonsense probably null
R7679:Zfp442 UTSW 2 150,252,917 (GRCm39) nonsense probably null
R7768:Zfp442 UTSW 2 150,250,241 (GRCm39) missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150,251,639 (GRCm39) missense probably benign 0.28
R7814:Zfp442 UTSW 2 150,251,402 (GRCm39) missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150,253,146 (GRCm39) missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150,251,096 (GRCm39) missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150,250,629 (GRCm39) missense unknown
R8528:Zfp442 UTSW 2 150,250,962 (GRCm39) missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150,250,093 (GRCm39) missense probably benign 0.30
R9269:Zfp442 UTSW 2 150,251,287 (GRCm39) missense probably benign 0.19
R9371:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R9401:Zfp442 UTSW 2 150,251,615 (GRCm39) missense possibly damaging 0.53
R9711:Zfp442 UTSW 2 150,250,207 (GRCm39) missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150,250,399 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCACATTGCTCACATTCAT -3'
(R):5'- AAGCAATGTGGTAAATCCTTTGCA -3'

Sequencing Primer
(F):5'- ACATTGCTCACATTCATAGGGTTTC -3'
(R):5'- GCTGTCATCTTCGAAGGCATCAAAG -3'
Posted On 2022-06-15