Incidental Mutation 'R9459:Gm14295'
ID 714745
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Name predicted gene 14295
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 176490405-176503016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 176499165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 5 (T5I)
Ref Sequence ENSEMBL: ENSMUSP00000113133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
AlphaFold A2BG91
Predicted Effect possibly damaging
Transcript: ENSMUST00000118012
AA Change: T5I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877
AA Change: T5I

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132883
AA Change: T5I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: T5I

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179435
AA Change: T4I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877
AA Change: T4I

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176,499,157 (GRCm39) missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176,502,474 (GRCm39) nonsense probably null
R2172:Gm14295 UTSW 2 176,502,895 (GRCm39) missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176,499,206 (GRCm39) missense probably benign 0.29
R4472:Gm14295 UTSW 2 176,501,386 (GRCm39) missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176,501,469 (GRCm39) missense probably damaging 0.99
R5082:Gm14295 UTSW 2 176,499,210 (GRCm39) nonsense probably null
R5311:Gm14295 UTSW 2 176,502,465 (GRCm39) missense probably benign 0.00
R5792:Gm14295 UTSW 2 176,502,807 (GRCm39) missense probably benign 0.10
R6170:Gm14295 UTSW 2 176,502,937 (GRCm39) unclassified probably benign
R6267:Gm14295 UTSW 2 176,500,782 (GRCm39) nonsense probably null
R6286:Gm14295 UTSW 2 176,501,361 (GRCm39) missense possibly damaging 0.52
R6743:Gm14295 UTSW 2 176,502,420 (GRCm39) missense probably damaging 1.00
R7456:Gm14295 UTSW 2 176,500,943 (GRCm39) missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176,502,722 (GRCm39) missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176,500,871 (GRCm39) missense probably benign 0.03
R8126:Gm14295 UTSW 2 176,502,658 (GRCm39) missense probably benign 0.04
R8209:Gm14295 UTSW 2 176,502,970 (GRCm39) missense unknown
R8292:Gm14295 UTSW 2 176,501,351 (GRCm39) missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176,501,307 (GRCm39) missense probably benign 0.24
R8412:Gm14295 UTSW 2 176,501,422 (GRCm39) missense probably damaging 1.00
R8993:Gm14295 UTSW 2 176,501,623 (GRCm39) missense possibly damaging 0.48
R9562:Gm14295 UTSW 2 176,499,162 (GRCm39) missense probably benign 0.34
R9565:Gm14295 UTSW 2 176,499,162 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCATCAGGTTCCCAGAGATC -3'
(R):5'- CCCAGTACCAGAGAAAGTATGTTAC -3'

Sequencing Primer
(F):5'- CAGGTTCCCAGAGATCATTTATTTAC -3'
(R):5'- CCATTGAACTTTAAAACCATGAGTG -3'
Posted On 2022-06-15