Incidental Mutation 'R9459:Gm14295'
ID 714745
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Name predicted gene 14295
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 176798612-176811223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 176807372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 5 (T5I)
Ref Sequence ENSEMBL: ENSMUSP00000113133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
AlphaFold A2BG91
Predicted Effect possibly damaging
Transcript: ENSMUST00000118012
AA Change: T5I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877
AA Change: T5I

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132883
AA Change: T5I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: T5I

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179435
AA Change: T4I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877
AA Change: T4I

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176807364 missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176810681 nonsense probably null
R2172:Gm14295 UTSW 2 176811102 missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176807413 missense probably benign 0.29
R4472:Gm14295 UTSW 2 176809593 missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176809676 missense probably damaging 0.99
R5082:Gm14295 UTSW 2 176807417 nonsense probably null
R5311:Gm14295 UTSW 2 176810672 missense probably benign 0.00
R5792:Gm14295 UTSW 2 176811014 missense probably benign 0.10
R6170:Gm14295 UTSW 2 176811144 unclassified probably benign
R6267:Gm14295 UTSW 2 176808989 nonsense probably null
R6286:Gm14295 UTSW 2 176809568 missense possibly damaging 0.52
R6743:Gm14295 UTSW 2 176810627 missense probably damaging 1.00
R7456:Gm14295 UTSW 2 176809150 missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176810929 missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176809078 missense probably benign 0.03
R8126:Gm14295 UTSW 2 176810865 missense probably benign 0.04
R8209:Gm14295 UTSW 2 176811177 missense unknown
R8292:Gm14295 UTSW 2 176809558 missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176809514 missense probably benign 0.24
R8412:Gm14295 UTSW 2 176809629 missense probably damaging 1.00
R8993:Gm14295 UTSW 2 176809830 missense possibly damaging 0.48
R9562:Gm14295 UTSW 2 176807369 missense probably benign 0.34
R9565:Gm14295 UTSW 2 176807369 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCATCAGGTTCCCAGAGATC -3'
(R):5'- CCCAGTACCAGAGAAAGTATGTTAC -3'

Sequencing Primer
(F):5'- CAGGTTCCCAGAGATCATTTATTTAC -3'
(R):5'- CCATTGAACTTTAAAACCATGAGTG -3'
Posted On 2022-06-15