Incidental Mutation 'R9459:Gbp3'
ID 714747
Institutional Source Beutler Lab
Gene Symbol Gbp3
Ensembl Gene ENSMUSG00000028268
Gene Name guanylate binding protein 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 142560026-142573209 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 142564946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029935] [ENSMUST00000029935] [ENSMUST00000106221] [ENSMUST00000106222] [ENSMUST00000128609] [ENSMUST00000142060] [ENSMUST00000199325]
AlphaFold Q61107
Predicted Effect probably null
Transcript: ENSMUST00000029935
SMART Domains Protein: ENSMUSP00000029935
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000029935
SMART Domains Protein: ENSMUSP00000029935
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106221
SMART Domains Protein: ENSMUSP00000101828
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 7.2e-126 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106222
SMART Domains Protein: ENSMUSP00000101829
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 275 9.6e-125 PFAM
Pfam:GBP_C 277 573 2.6e-126 PFAM
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128609
SMART Domains Protein: ENSMUSP00000117991
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 83 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142060
SMART Domains Protein: ENSMUSP00000120131
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 136 4.8e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199325
SMART Domains Protein: ENSMUSP00000142411
Gene: ENSMUSG00000028268

DomainStartEndE-ValueType
Pfam:GBP 12 57 8.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP4, are induced by interferon and hydrolyze GTP to both GDP and GMP (Vestal, 2005 [PubMed 16108726]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Gbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Gbp3 APN 3 142565244 unclassified probably benign
IGL01067:Gbp3 APN 3 142566597 splice site probably null
IGL02965:Gbp3 APN 3 142567582 missense probably benign 0.31
R0136:Gbp3 UTSW 3 142564101 splice site probably null
R0609:Gbp3 UTSW 3 142567772 missense probably damaging 0.99
R0671:Gbp3 UTSW 3 142565390 missense probably benign 0.17
R0673:Gbp3 UTSW 3 142565254 missense probably benign 0.45
R0786:Gbp3 UTSW 3 142570971 missense possibly damaging 0.67
R2511:Gbp3 UTSW 3 142570582 missense probably benign 0.31
R3909:Gbp3 UTSW 3 142566338 unclassified probably benign
R3912:Gbp3 UTSW 3 142566338 unclassified probably benign
R4816:Gbp3 UTSW 3 142567574 missense probably damaging 0.99
R5822:Gbp3 UTSW 3 142566478 missense probably benign 0.01
R6046:Gbp3 UTSW 3 142567799 missense possibly damaging 0.81
R6328:Gbp3 UTSW 3 142569058 missense probably benign 0.01
R7186:Gbp3 UTSW 3 142564162 missense probably damaging 0.97
R7536:Gbp3 UTSW 3 142566395 missense probably damaging 1.00
R7543:Gbp3 UTSW 3 142566580 missense probably damaging 0.97
R7602:Gbp3 UTSW 3 142569061 missense probably benign 0.00
R7677:Gbp3 UTSW 3 142560503 start gained probably benign
R7764:Gbp3 UTSW 3 142565263 missense probably benign 0.37
R7923:Gbp3 UTSW 3 142567612 missense probably damaging 1.00
R9099:Gbp3 UTSW 3 142565287 missense probably benign 0.02
R9102:Gbp3 UTSW 3 142567825 missense probably benign 0.01
R9440:Gbp3 UTSW 3 142566574 missense possibly damaging 0.63
R9760:Gbp3 UTSW 3 142570522 missense probably benign 0.01
X0025:Gbp3 UTSW 3 142566432 missense probably benign 0.42
X0062:Gbp3 UTSW 3 142561774 missense probably damaging 1.00
Z1176:Gbp3 UTSW 3 142561863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGAATGTAGCAGTATCTTCC -3'
(R):5'- AATAGTCCCTTTGTCTGAGCC -3'

Sequencing Primer
(F):5'- GAATGTAGCAGTATCTTCCAATTTTG -3'
(R):5'- GTCTGAGCCTACTGTAATTCAAGAC -3'
Posted On 2022-06-15