Incidental Mutation 'R9459:Ccdc30'
ID 714749
Institutional Source Beutler Lab
Gene Symbol Ccdc30
Ensembl Gene ENSMUSG00000028637
Gene Name coiled-coil domain containing 30
Synonyms 4930445I03Rik, 1700041C02Rik, 1700001O02Rik, 1700111D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 119322893-119415521 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119377273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 81 (R81G)
Ref Sequence ENSEMBL: ENSMUSP00000081332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044781] [ENSMUST00000063642] [ENSMUST00000084307] [ENSMUST00000143494]
AlphaFold Q8BVF4
Predicted Effect probably benign
Transcript: ENSMUST00000044781
SMART Domains Protein: ENSMUSP00000047534
Gene: ENSMUSG00000028637

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
Pfam:DUF4686 103 286 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063642
SMART Domains Protein: ENSMUSP00000070621
Gene: ENSMUSG00000028637

DomainStartEndE-ValueType
Pfam:DUF4686 170 547 5.1e-155 PFAM
low complexity region 555 568 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084307
AA Change: R81G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081332
Gene: ENSMUSG00000028637
AA Change: R81G

DomainStartEndE-ValueType
coiled coil region 16 43 N/A INTRINSIC
coiled coil region 85 115 N/A INTRINSIC
low complexity region 209 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143494
SMART Domains Protein: ENSMUSP00000118202
Gene: ENSMUSG00000028637

DomainStartEndE-ValueType
Pfam:DUF4686 31 169 3.1e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Ccdc30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ccdc30 APN 4 119393579 missense possibly damaging 0.93
IGL01546:Ccdc30 APN 4 119398188 missense probably damaging 0.99
IGL01691:Ccdc30 APN 4 119393564 missense probably damaging 0.96
IGL02178:Ccdc30 APN 4 119349724 unclassified probably benign
IGL02341:Ccdc30 APN 4 119356781 missense possibly damaging 0.83
IGL03063:Ccdc30 APN 4 119349767 missense possibly damaging 0.68
IGL03394:Ccdc30 APN 4 119359582 missense probably damaging 1.00
doubledip UTSW 4 119324056 missense probably damaging 0.99
ladle UTSW 4 119333723 critical splice acceptor site probably null
G1patch:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R1587:Ccdc30 UTSW 4 119353176 missense probably damaging 1.00
R1604:Ccdc30 UTSW 4 119331596 missense probably damaging 0.99
R1842:Ccdc30 UTSW 4 119331127 missense probably benign
R1962:Ccdc30 UTSW 4 119339791 missense probably benign 0.00
R2157:Ccdc30 UTSW 4 119333724 splice site probably benign
R2314:Ccdc30 UTSW 4 119324566 nonsense probably null
R2362:Ccdc30 UTSW 4 119324056 missense probably damaging 0.99
R3407:Ccdc30 UTSW 4 119324581 missense possibly damaging 0.63
R3755:Ccdc30 UTSW 4 119367808 critical splice donor site probably null
R3938:Ccdc30 UTSW 4 119352673 missense probably benign 0.02
R4762:Ccdc30 UTSW 4 119333588 missense probably damaging 0.98
R5014:Ccdc30 UTSW 4 119393627 missense possibly damaging 0.96
R5635:Ccdc30 UTSW 4 119359674 missense possibly damaging 0.66
R6282:Ccdc30 UTSW 4 119324017 missense probably damaging 0.98
R6382:Ccdc30 UTSW 4 119404166 missense possibly damaging 0.93
R6725:Ccdc30 UTSW 4 119331599 missense probably damaging 1.00
R6746:Ccdc30 UTSW 4 119356718 missense probably benign 0.03
R7230:Ccdc30 UTSW 4 119339782 missense possibly damaging 0.89
R7576:Ccdc30 UTSW 4 119349866 missense probably damaging 1.00
R7673:Ccdc30 UTSW 4 119353172 missense probably damaging 1.00
R7719:Ccdc30 UTSW 4 119333616 missense probably damaging 1.00
R7895:Ccdc30 UTSW 4 119352713 splice site probably null
R8021:Ccdc30 UTSW 4 119352679 missense probably benign 0.00
R8113:Ccdc30 UTSW 4 119373746 missense probably benign 0.32
R8696:Ccdc30 UTSW 4 119377308 missense possibly damaging 0.92
R8713:Ccdc30 UTSW 4 119404207 missense probably damaging 0.99
R8885:Ccdc30 UTSW 4 119324562 missense probably damaging 0.97
R8948:Ccdc30 UTSW 4 119324161 missense probably benign
R9337:Ccdc30 UTSW 4 119333723 critical splice acceptor site probably null
R9354:Ccdc30 UTSW 4 119373653 missense possibly damaging 0.86
R9563:Ccdc30 UTSW 4 119393624 missense possibly damaging 0.91
R9565:Ccdc30 UTSW 4 119393624 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AACCGCGTTATACGTCACTTC -3'
(R):5'- TTGTTAGGACCATTTCAAGAACCC -3'

Sequencing Primer
(F):5'- GCGTTATACGTCACTTCATTGTATG -3'
(R):5'- TTGGCTCAGTGGTTAAGAACACC -3'
Posted On 2022-06-15