Incidental Mutation 'R9459:Abcb1a'
ID 714750
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene Name ATP-binding cassette, sub-family B member 1A
Synonyms Evi32, multiple drug resistant 1a, Pgp, MDR3, Pgy-3, Mdr1a, P-glycoprotein, P-gp, Pgy3, mdr-3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 8710077-8798575 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 8735414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
AlphaFold P21447
PDB Structure Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000047753
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8,736,257 (GRCm39) missense probably benign 0.01
IGL00898:Abcb1a APN 5 8,783,690 (GRCm39) missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8,782,388 (GRCm39) missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8,724,687 (GRCm39) missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8,752,550 (GRCm39) missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8,748,637 (GRCm39) missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8,765,065 (GRCm39) critical splice donor site probably null
IGL01820:Abcb1a APN 5 8,765,896 (GRCm39) splice site probably benign
IGL02499:Abcb1a APN 5 8,776,807 (GRCm39) missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8,773,245 (GRCm39) splice site probably null
IGL02954:Abcb1a APN 5 8,782,341 (GRCm39) missense probably benign 0.00
IGL03018:Abcb1a APN 5 8,752,451 (GRCm39) missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8,764,887 (GRCm39) missense probably benign 0.00
IGL03292:Abcb1a APN 5 8,765,827 (GRCm39) missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8,744,153 (GRCm39) missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8,763,281 (GRCm39) missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8,748,535 (GRCm39) missense probably benign 0.01
R0595:Abcb1a UTSW 5 8,790,417 (GRCm39) missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8,748,539 (GRCm39) missense probably benign 0.13
R0811:Abcb1a UTSW 5 8,763,229 (GRCm39) missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8,763,229 (GRCm39) missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8,724,856 (GRCm39) splice site probably benign
R0948:Abcb1a UTSW 5 8,790,621 (GRCm39) splice site probably null
R1292:Abcb1a UTSW 5 8,763,343 (GRCm39) missense probably benign 0.00
R1318:Abcb1a UTSW 5 8,751,621 (GRCm39) missense probably benign 0.31
R1459:Abcb1a UTSW 5 8,752,920 (GRCm39) missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8,736,300 (GRCm39) critical splice donor site probably null
R1514:Abcb1a UTSW 5 8,724,791 (GRCm39) missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8,763,202 (GRCm39) missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8,788,747 (GRCm39) missense probably benign 0.30
R2844:Abcb1a UTSW 5 8,736,164 (GRCm39) missense probably benign 0.02
R3709:Abcb1a UTSW 5 8,788,738 (GRCm39) missense probably benign 0.03
R3755:Abcb1a UTSW 5 8,797,403 (GRCm39) missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8,765,068 (GRCm39) splice site probably null
R4401:Abcb1a UTSW 5 8,752,390 (GRCm39) missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8,769,981 (GRCm39) splice site probably benign
R4539:Abcb1a UTSW 5 8,765,793 (GRCm39) missense probably benign
R4635:Abcb1a UTSW 5 8,764,927 (GRCm39) missense probably benign
R4740:Abcb1a UTSW 5 8,752,280 (GRCm39) critical splice donor site probably null
R4757:Abcb1a UTSW 5 8,787,632 (GRCm39) missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8,765,732 (GRCm39) splice site probably null
R4792:Abcb1a UTSW 5 8,796,657 (GRCm39) critical splice donor site probably null
R4829:Abcb1a UTSW 5 8,773,214 (GRCm39) missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8,787,773 (GRCm39) critical splice donor site probably null
R5140:Abcb1a UTSW 5 8,752,154 (GRCm39) missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8,764,937 (GRCm39) missense probably benign
R5355:Abcb1a UTSW 5 8,776,873 (GRCm39) missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8,752,946 (GRCm39) missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8,724,818 (GRCm39) missense probably benign
R5557:Abcb1a UTSW 5 8,764,949 (GRCm39) missense probably benign 0.01
R5572:Abcb1a UTSW 5 8,765,108 (GRCm39) splice site probably null
R5702:Abcb1a UTSW 5 8,787,752 (GRCm39) missense probably benign 0.15
R5753:Abcb1a UTSW 5 8,773,160 (GRCm39) missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8,733,426 (GRCm39) missense probably benign 0.01
R5895:Abcb1a UTSW 5 8,752,216 (GRCm39) missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8,769,030 (GRCm39) missense probably benign 0.01
R6555:Abcb1a UTSW 5 8,752,468 (GRCm39) missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8,782,364 (GRCm39) missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8,751,628 (GRCm39) missense probably benign 0.28
R7000:Abcb1a UTSW 5 8,752,823 (GRCm39) missense probably benign 0.19
R7102:Abcb1a UTSW 5 8,744,072 (GRCm39) missense probably benign 0.01
R7172:Abcb1a UTSW 5 8,752,399 (GRCm39) missense probably benign 0.00
R7313:Abcb1a UTSW 5 8,773,187 (GRCm39) missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8,765,771 (GRCm39) nonsense probably null
R7718:Abcb1a UTSW 5 8,765,788 (GRCm39) missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8,736,132 (GRCm39) missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8,748,623 (GRCm39) missense probably benign 0.06
R7943:Abcb1a UTSW 5 8,736,222 (GRCm39) missense probably benign
R8040:Abcb1a UTSW 5 8,765,035 (GRCm39) missense probably benign 0.00
R8086:Abcb1a UTSW 5 8,724,833 (GRCm39) missense probably benign
R8271:Abcb1a UTSW 5 8,736,212 (GRCm39) missense probably benign 0.41
R8367:Abcb1a UTSW 5 8,736,221 (GRCm39) missense probably benign 0.00
R8520:Abcb1a UTSW 5 8,735,346 (GRCm39) missense possibly damaging 0.67
R8680:Abcb1a UTSW 5 8,735,371 (GRCm39) missense probably damaging 0.99
R8820:Abcb1a UTSW 5 8,773,204 (GRCm39) missense possibly damaging 0.69
R8996:Abcb1a UTSW 5 8,769,069 (GRCm39) missense probably benign 0.00
R9114:Abcb1a UTSW 5 8,788,702 (GRCm39) nonsense probably null
R9127:Abcb1a UTSW 5 8,724,707 (GRCm39) missense probably benign
R9187:Abcb1a UTSW 5 8,765,016 (GRCm39) missense probably benign
R9294:Abcb1a UTSW 5 8,736,171 (GRCm39) missense probably benign 0.02
R9581:Abcb1a UTSW 5 8,790,428 (GRCm39) missense possibly damaging 0.66
R9617:Abcb1a UTSW 5 8,797,353 (GRCm39) critical splice acceptor site probably null
R9676:Abcb1a UTSW 5 8,714,548 (GRCm39) missense possibly damaging 0.87
R9682:Abcb1a UTSW 5 8,752,507 (GRCm39) missense probably benign 0.44
R9790:Abcb1a UTSW 5 8,748,604 (GRCm39) missense probably damaging 1.00
R9791:Abcb1a UTSW 5 8,748,604 (GRCm39) missense probably damaging 1.00
Z1177:Abcb1a UTSW 5 8,796,544 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTACTATTACACCGGGATTGG -3'
(R):5'- ATTCAGTGCCAGGCAAGCAG -3'

Sequencing Primer
(F):5'- ACCGGGATTGGTGCTGG -3'
(R):5'- TGCCAGGCAAGCAGGAGTC -3'
Posted On 2022-06-15