Incidental Mutation 'R9459:Pkd2'
ID 714753
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Name polycystin 2, transient receptor potential cation channel
Synonyms TRPP2, polycystin-2, C030034P18Rik, PC2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 104607316-104653685 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104614800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 214 (Y214C)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
AlphaFold O35245
Predicted Effect probably damaging
Transcript: ENSMUST00000086831
AA Change: Y214C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: Y214C

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104,631,001 (GRCm39) missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104,646,750 (GRCm39) splice site probably benign
IGL01805:Pkd2 APN 5 104,630,959 (GRCm39) missense probably benign 0.41
IGL02146:Pkd2 APN 5 104,637,157 (GRCm39) missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104,624,941 (GRCm39) missense probably benign 0.38
IGL02481:Pkd2 APN 5 104,634,636 (GRCm39) missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104,628,026 (GRCm39) missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104,642,753 (GRCm39) splice site probably benign
IGL03409:Pkd2 APN 5 104,637,215 (GRCm39) nonsense probably null
Nephro UTSW 5 104,634,672 (GRCm39) missense probably damaging 1.00
reggae UTSW 5 104,625,045 (GRCm39) splice site probably null
samba UTSW 5 104,624,989 (GRCm39) missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104,651,471 (GRCm39) nonsense probably null
PIT1430001:Pkd2 UTSW 5 104,607,654 (GRCm39) missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104,651,382 (GRCm39) missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104,651,382 (GRCm39) missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104,603,671 (GRCm39) unclassified probably benign
R0070:Pkd2 UTSW 5 104,614,856 (GRCm39) missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104,614,856 (GRCm39) missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104,607,716 (GRCm39) missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104,625,032 (GRCm39) missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104,603,471 (GRCm39) unclassified probably benign
R1277:Pkd2 UTSW 5 104,650,225 (GRCm39) missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104,631,094 (GRCm39) missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104,634,672 (GRCm39) missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104,626,790 (GRCm39) missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104,614,744 (GRCm39) splice site probably null
R2080:Pkd2 UTSW 5 104,624,989 (GRCm39) missense probably benign 0.01
R2081:Pkd2 UTSW 5 104,608,077 (GRCm39) missense probably benign 0.00
R2098:Pkd2 UTSW 5 104,626,768 (GRCm39) missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104,631,042 (GRCm39) missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104,603,456 (GRCm39) unclassified probably benign
R2163:Pkd2 UTSW 5 104,603,543 (GRCm39) unclassified probably benign
R3401:Pkd2 UTSW 5 104,628,193 (GRCm39) missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104,637,285 (GRCm39) splice site probably null
R3733:Pkd2 UTSW 5 104,637,285 (GRCm39) splice site probably null
R4409:Pkd2 UTSW 5 104,614,750 (GRCm39) splice site silent
R4582:Pkd2 UTSW 5 104,650,210 (GRCm39) nonsense probably null
R5189:Pkd2 UTSW 5 104,607,785 (GRCm39) missense probably benign 0.22
R5191:Pkd2 UTSW 5 104,634,547 (GRCm39) missense probably benign 0.05
R5195:Pkd2 UTSW 5 104,634,547 (GRCm39) missense probably benign 0.05
R5198:Pkd2 UTSW 5 104,630,958 (GRCm39) missense probably benign 0.06
R5326:Pkd2 UTSW 5 104,634,515 (GRCm39) splice site silent
R5406:Pkd2 UTSW 5 104,628,198 (GRCm39) missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104,634,515 (GRCm39) splice site silent
R5543:Pkd2 UTSW 5 104,637,199 (GRCm39) missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104,646,372 (GRCm39) missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104,646,405 (GRCm39) missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104,625,045 (GRCm39) splice site probably null
R5924:Pkd2 UTSW 5 104,646,424 (GRCm39) missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104,634,546 (GRCm39) nonsense probably null
R6455:Pkd2 UTSW 5 104,607,790 (GRCm39) missense probably benign 0.00
R6495:Pkd2 UTSW 5 104,637,159 (GRCm39) missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104,628,195 (GRCm39) missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104,624,909 (GRCm39) missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104,634,523 (GRCm39) missense probably benign 0.00
R7477:Pkd2 UTSW 5 104,631,108 (GRCm39) missense probably benign 0.19
R7560:Pkd2 UTSW 5 104,628,219 (GRCm39) missense probably damaging 1.00
R7867:Pkd2 UTSW 5 104,630,986 (GRCm39) missense probably damaging 1.00
R7894:Pkd2 UTSW 5 104,628,103 (GRCm39) missense probably damaging 1.00
R8251:Pkd2 UTSW 5 104,646,353 (GRCm39) missense probably benign 0.01
R8360:Pkd2 UTSW 5 104,607,653 (GRCm39) nonsense probably null
R8368:Pkd2 UTSW 5 104,607,653 (GRCm39) nonsense probably null
R8526:Pkd2 UTSW 5 104,637,102 (GRCm39) missense probably damaging 1.00
R8751:Pkd2 UTSW 5 104,637,151 (GRCm39) missense probably damaging 1.00
R8956:Pkd2 UTSW 5 104,631,090 (GRCm39) missense probably damaging 1.00
R9101:Pkd2 UTSW 5 104,628,230 (GRCm39) missense probably damaging 1.00
R9271:Pkd2 UTSW 5 104,626,959 (GRCm39) splice site probably null
R9452:Pkd2 UTSW 5 104,614,841 (GRCm39) missense probably damaging 1.00
R9541:Pkd2 UTSW 5 104,607,927 (GRCm39) missense probably damaging 0.98
R9671:Pkd2 UTSW 5 104,637,256 (GRCm39) missense probably damaging 1.00
R9682:Pkd2 UTSW 5 104,626,790 (GRCm39) missense probably damaging 1.00
R9737:Pkd2 UTSW 5 104,651,349 (GRCm39) missense possibly damaging 0.92
Z1088:Pkd2 UTSW 5 104,646,727 (GRCm39) missense probably damaging 1.00
Z1176:Pkd2 UTSW 5 104,607,915 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AACGCGTTTACTGTCAATATCGAC -3'
(R):5'- CCGATAATGAACCGGTGAGC -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- ACCGGTGAGCAGAGACC -3'
Posted On 2022-06-15