Incidental Mutation 'R9459:Uba3'
ID 714758
Institutional Source Beutler Lab
Gene Symbol Uba3
Ensembl Gene ENSMUSG00000030061
Gene Name ubiquitin-like modifier activating enzyme 3
Synonyms ubiquitin activating enzyme 3, A830034N06Rik, Ube1c
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 97183670-97205647 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97189598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 281 (I281V)
Ref Sequence ENSEMBL: ENSMUSP00000086701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089287] [ENSMUST00000164744] [ENSMUST00000204056]
AlphaFold Q8C878
Predicted Effect probably benign
Transcript: ENSMUST00000089287
AA Change: I281V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086701
Gene: ENSMUSG00000030061
AA Change: I281V

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:ThiF 53 369 2.6e-69 PFAM
E2_bind 374 462 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164744
AA Change: I267V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061
AA Change: I267V

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is the catalytic subunit of the enzyme that activates NEDD8, a ubiquitin-like molecule that binds to its target proteins through an enzymatic reaction analagous to ubiquitylation. Embryonic mice deficient for this protein die prior to implantation and display apoptosis of the inner cell mass. Trophoblastic cells cannot enter S phase, demonstrating that this gene is required for cell cycle progression during embryogenesis. Two pseudogenes have been found for this gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die at the peri-implantation stage. Mutants exhibit selective apoptosis of the inner cell mass but not of trophoblastic cells. Moreover, the trophoblastic cells fail to enter the S phase of the endoreduplication cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Uba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0295:Uba3 UTSW 6 97191583 missense possibly damaging 0.71
R0554:Uba3 UTSW 6 97191260 splice site probably null
R0780:Uba3 UTSW 6 97186705 nonsense probably null
R1572:Uba3 UTSW 6 97185337 splice site probably benign
R1759:Uba3 UTSW 6 97196904 missense probably damaging 1.00
R1806:Uba3 UTSW 6 97199269 missense possibly damaging 0.87
R2076:Uba3 UTSW 6 97199280 missense probably damaging 1.00
R2907:Uba3 UTSW 6 97203553 missense probably benign 0.00
R3237:Uba3 UTSW 6 97186240 missense probably damaging 1.00
R5238:Uba3 UTSW 6 97201935 nonsense probably null
R6293:Uba3 UTSW 6 97196908 missense probably damaging 1.00
R7198:Uba3 UTSW 6 97205551 start codon destroyed probably null 0.02
R8066:Uba3 UTSW 6 97201921 missense probably damaging 0.97
R8087:Uba3 UTSW 6 97185383 missense possibly damaging 0.76
R9016:Uba3 UTSW 6 97185733 nonsense probably null
R9100:Uba3 UTSW 6 97186710 missense probably damaging 0.99
R9356:Uba3 UTSW 6 97184850 missense probably benign 0.08
R9582:Uba3 UTSW 6 97191530 missense probably damaging 0.96
R9801:Uba3 UTSW 6 97185674 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CGTCAGATGGATGTCGATCTC -3'
(R):5'- GCCTAAAGAGCAGCCTTTTGGAG -3'

Sequencing Primer
(F):5'- GCCATAGAGCTGTGGTTCTCAAC -3'
(R):5'- GGAGGTAATTTAACAATCTAGAC -3'
Posted On 2022-06-15