Incidental Mutation 'R9459:Rassf4'
ID 714759
Institutional Source Beutler Lab
Gene Symbol Rassf4
Ensembl Gene ENSMUSG00000042129
Gene Name Ras association (RalGDS/AF-6) domain family member 4
Synonyms 3830411C14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 116633008-116673952 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 116641788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035842] [ENSMUST00000035842] [ENSMUST00000203029] [ENSMUST00000204203] [ENSMUST00000204576]
AlphaFold Q8CB96
Predicted Effect probably null
Transcript: ENSMUST00000035842
SMART Domains Protein: ENSMUSP00000048267
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 1.36e-15 SMART
Pfam:Nore1-SARAH 276 315 1.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035842
SMART Domains Protein: ENSMUSP00000048267
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 1.36e-15 SMART
Pfam:Nore1-SARAH 276 315 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203029
SMART Domains Protein: ENSMUSP00000144786
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 8.7e-18 SMART
Pfam:Nore1-SARAH 276 303 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204203
Predicted Effect probably benign
Transcript: ENSMUST00000204576
SMART Domains Protein: ENSMUSP00000145394
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of this gene has not yet been determined but may involve a role in tumor suppression. Alternative splicing of this gene results in several transcript variants; however, most of the variants have not been fully described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Rassf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Rassf4 APN 6 116645128 missense possibly damaging 0.47
IGL01132:Rassf4 APN 6 116659607 splice site probably benign
IGL01637:Rassf4 APN 6 116641690 missense probably damaging 1.00
IGL02000:Rassf4 APN 6 116645972 missense probably benign 0.20
IGL02748:Rassf4 APN 6 116639457 missense possibly damaging 0.93
IGL02976:Rassf4 APN 6 116638248 missense probably damaging 0.96
IGL03394:Rassf4 APN 6 116641747 missense probably damaging 1.00
R0573:Rassf4 UTSW 6 116647555 splice site probably benign
R0599:Rassf4 UTSW 6 116645936 missense probably damaging 1.00
R1741:Rassf4 UTSW 6 116639489 missense probably damaging 1.00
R1750:Rassf4 UTSW 6 116640267 missense probably damaging 1.00
R2117:Rassf4 UTSW 6 116645127 missense possibly damaging 0.86
R2369:Rassf4 UTSW 6 116638297 missense probably damaging 0.97
R2916:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R2918:Rassf4 UTSW 6 116641740 missense probably damaging 1.00
R4829:Rassf4 UTSW 6 116645142 missense possibly damaging 0.80
R5716:Rassf4 UTSW 6 116661867 missense probably benign 0.01
R6769:Rassf4 UTSW 6 116641472 missense possibly damaging 0.95
R7304:Rassf4 UTSW 6 116640317 missense probably damaging 0.99
R7981:Rassf4 UTSW 6 116640257 missense probably damaging 1.00
R8890:Rassf4 UTSW 6 116640344 missense probably damaging 1.00
R8921:Rassf4 UTSW 6 116661936 splice site probably benign
R9516:Rassf4 UTSW 6 116640304 missense possibly damaging 0.89
R9698:Rassf4 UTSW 6 116641701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTAGAATCCCAGGGAC -3'
(R):5'- GCACCTTCTTCAGAGTGCTC -3'

Sequencing Primer
(F):5'- TAGAATCCCAGGGACACCGG -3'
(R):5'- TCTGAGGACACATAGCTCCTTGAG -3'
Posted On 2022-06-15