Incidental Mutation 'R9459:Ap3b2'
ID 714761
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81123651 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 400 (N400S)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably benign
Transcript: ENSMUST00000082090
AA Change: N400S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: N400S

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGCCTAAAGTCAGCAGAAG -3'
(R):5'- AGGAGGAGGCAAATTGACCTTC -3'

Sequencing Primer
(F):5'- GGGATCTAAGGAAACATTTCTCCAGC -3'
(R):5'- AGGAGGCAAATTGACCTTCTTGTG -3'
Posted On 2022-06-15