Incidental Mutation 'R9459:Kctd13'
ID 714763
Institutional Source Beutler Lab
Gene Symbol Kctd13
Ensembl Gene ENSMUSG00000030685
Gene Name potassium channel tetramerisation domain containing 13
Synonyms Pdip1, Poldip1, 1500003N18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 126928879-126945631 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126945082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 317 (D317E)
Ref Sequence ENSEMBL: ENSMUSP00000032924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032924] [ENSMUST00000052937] [ENSMUST00000106339] [ENSMUST00000106340]
AlphaFold Q8BGV7
Predicted Effect probably damaging
Transcript: ENSMUST00000032924
AA Change: D317E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032924
Gene: ENSMUSG00000030685
AA Change: D317E

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
BTB 41 141 6.48e-15 SMART
low complexity region 276 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052937
SMART Domains Protein: ENSMUSP00000049848
Gene: ENSMUSG00000046378

DomainStartEndE-ValueType
Pfam:Asp_Arg_Hydrox 1 92 5.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106339
SMART Domains Protein: ENSMUSP00000101946
Gene: ENSMUSG00000046378

DomainStartEndE-ValueType
Pfam:Asp_Arg_Hydrox 1 92 5.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106340
SMART Domains Protein: ENSMUSP00000101947
Gene: ENSMUSG00000046378

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
low complexity region 115 128 N/A INTRINSIC
low complexity region 138 153 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Pfam:Asp_Arg_Hydrox 191 342 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced synaptic transmission, abnormal hippocampal pyramidal neuron dendrite morphology, and hyperactivity with no detectable changes in body weight, brain size or neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Kctd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02617:Kctd13 APN 7 126942332 missense possibly damaging 0.64
IGL02890:Kctd13 APN 7 126930731 missense probably benign 0.01
IGL03339:Kctd13 APN 7 126945018 missense probably benign
R5322:Kctd13 UTSW 7 126929206 missense probably damaging 1.00
R6365:Kctd13 UTSW 7 126930690 missense probably damaging 1.00
R7585:Kctd13 UTSW 7 126929286 missense possibly damaging 0.51
R8036:Kctd13 UTSW 7 126929242 missense possibly damaging 0.81
R8846:Kctd13 UTSW 7 126945019 missense probably benign
R9153:Kctd13 UTSW 7 126942155 missense probably damaging 1.00
R9311:Kctd13 UTSW 7 126942173 missense probably damaging 1.00
R9610:Kctd13 UTSW 7 126945008 missense probably damaging 1.00
R9611:Kctd13 UTSW 7 126945008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGGATCTTTGAGGAGACAC -3'
(R):5'- TGCTGGAATGTACCATGTGG -3'

Sequencing Primer
(F):5'- GATCTTTGAGGAGACACTGAACATC -3'
(R):5'- AGCAGTGAGTGGTGATGACTG -3'
Posted On 2022-06-15