Incidental Mutation 'R9459:Chrnb3'
ID 714765
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Name cholinergic receptor, nicotinic, beta polypeptide 3
Synonyms Acrb3, 5730417K16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 27368711-27399730 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 27393856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 207 (W207*)
Ref Sequence ENSEMBL: ENSMUSP00000052297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
AlphaFold Q8BMN3
Predicted Effect probably null
Transcript: ENSMUST00000060943
AA Change: W207*
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: W207*

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079463
AA Change: W192*
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: W192*

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211104
AA Change: W207*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27385101 missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27394174 missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27396804 unclassified probably benign
IGL02403:Chrnb3 APN 8 27393808 missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27393369 missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27386806 missense probably damaging 0.96
R0178:Chrnb3 UTSW 8 27393364 missense probably damaging 1.00
R0736:Chrnb3 UTSW 8 27385050 missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27393700 missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27386811 missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27394234 missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27393781 missense probably damaging 1.00
R3020:Chrnb3 UTSW 8 27396784 missense probably benign
R3981:Chrnb3 UTSW 8 27394006 missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27393993 missense probably damaging 1.00
R4276:Chrnb3 UTSW 8 27393751 missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27396733 missense possibly damaging 0.84
R4515:Chrnb3 UTSW 8 27385090 missense probably damaging 1.00
R4688:Chrnb3 UTSW 8 27394119 missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27394230 missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27394132 missense probably damaging 1.00
R6333:Chrnb3 UTSW 8 27393327 missense probably damaging 0.96
R6454:Chrnb3 UTSW 8 27393375 missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27393961 missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27394560 missense unknown
R8156:Chrnb3 UTSW 8 27393654 missense probably benign 0.13
R8421:Chrnb3 UTSW 8 27396690 missense probably damaging 1.00
R8884:Chrnb3 UTSW 8 27393918 missense possibly damaging 0.90
R9244:Chrnb3 UTSW 8 27394566 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAGGGCTCTCTCATGACC -3'
(R):5'- TTCGTCGGAGGGTAGGTAGAAC -3'

Sequencing Primer
(F):5'- TCATGACCAAGGCCATTGTG -3'
(R):5'- GTAGAACACCAGGACCGTG -3'
Posted On 2022-06-15