Incidental Mutation 'R9459:Nectin1'
ID 714766
Institutional Source Beutler Lab
Gene Symbol Nectin1
Ensembl Gene ENSMUSG00000032012
Gene Name nectin cell adhesion molecule 1
Synonyms HveC, Pvrl1, HIgR, nectin-1, PRR, Cd111, PRR1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 43743984-43807461 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 43803793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Alanine at position 442 (E442A)
Ref Sequence ENSEMBL: ENSMUSP00000034510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034510] [ENSMUST00000216893]
AlphaFold Q9JKF6
PDB Structure Solution structure of the third Immunoglobulin-like domain of nectin-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034510
AA Change: E442A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034510
Gene: ENSMUSG00000032012
AA Change: E442A

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
IG 36 143 8.51e-7 SMART
Pfam:C2-set_2 148 237 8.5e-21 PFAM
IG 254 334 1.28e-1 SMART
transmembrane domain 355 377 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216893
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice exhibit eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses, and open eyelids at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Nectin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nectin1 APN 9 43791258 nonsense probably null
IGL01939:Nectin1 APN 9 43792574 unclassified probably benign
IGL01978:Nectin1 APN 9 43792147 missense probably damaging 0.99
IGL02795:Nectin1 APN 9 43803552 missense probably benign
K3955:Nectin1 UTSW 9 43792078 missense probably damaging 1.00
R0563:Nectin1 UTSW 9 43791045 missense probably benign
R1439:Nectin1 UTSW 9 43792099 missense possibly damaging 0.78
R1822:Nectin1 UTSW 9 43791077 nonsense probably null
R4356:Nectin1 UTSW 9 43792505 missense probably benign 0.22
R5153:Nectin1 UTSW 9 43803498 missense probably damaging 0.99
R5516:Nectin1 UTSW 9 43803793 missense probably benign 0.03
R5864:Nectin1 UTSW 9 43791310 missense probably damaging 1.00
R6903:Nectin1 UTSW 9 43791882 missense possibly damaging 0.95
R7791:Nectin1 UTSW 9 43792039 missense probably benign 0.08
R7878:Nectin1 UTSW 9 43803901 missense probably benign 0.10
R8046:Nectin1 UTSW 9 43792501 missense probably benign 0.00
R8945:Nectin1 UTSW 9 43791940 missense probably benign
R9526:Nectin1 UTSW 9 43791072 missense probably benign
R9744:Nectin1 UTSW 9 43803943 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTCAAGGGTGACTACAGCAC -3'
(R):5'- GGGCTACACATACCACTCTTTC -3'

Sequencing Primer
(F):5'- CCAAGAAGCACGTGTACGGC -3'
(R):5'- ATGAAAGACCCGTCGTTCTG -3'
Posted On 2022-06-15