Incidental Mutation 'R9459:Pcnt'
ID 714768
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Name pericentrin (kendrin)
Synonyms m275Asp, m239Asp, Pcnt2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 76187097-76278620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76228572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1531 (L1531P)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000001179
AA Change: L1531P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: L1531P

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000217838
AA Change: L1531P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76,258,738 (GRCm39) nonsense probably null
IGL01307:Pcnt APN 10 76,247,422 (GRCm39) missense probably damaging 1.00
IGL01549:Pcnt APN 10 76,203,320 (GRCm39) splice site probably null
IGL01576:Pcnt APN 10 76,204,656 (GRCm39) missense probably damaging 0.99
IGL01611:Pcnt APN 10 76,272,258 (GRCm39) critical splice donor site probably null
IGL01630:Pcnt APN 10 76,256,080 (GRCm39) missense probably damaging 0.99
IGL01647:Pcnt APN 10 76,205,835 (GRCm39) nonsense probably null
IGL01689:Pcnt APN 10 76,247,487 (GRCm39) missense probably damaging 1.00
IGL01690:Pcnt APN 10 76,228,609 (GRCm39) missense probably damaging 1.00
IGL01723:Pcnt APN 10 76,254,333 (GRCm39) missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76,240,362 (GRCm39) missense probably damaging 1.00
IGL01958:Pcnt APN 10 76,269,513 (GRCm39) missense probably damaging 0.96
IGL02210:Pcnt APN 10 76,225,053 (GRCm39) missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02228:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02237:Pcnt APN 10 76,188,818 (GRCm39) missense probably damaging 1.00
IGL02279:Pcnt APN 10 76,239,599 (GRCm39) missense probably damaging 1.00
IGL02303:Pcnt APN 10 76,278,393 (GRCm39) splice site probably benign
IGL02355:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02362:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02428:Pcnt APN 10 76,265,090 (GRCm39) missense probably damaging 0.99
IGL02536:Pcnt APN 10 76,216,063 (GRCm39) missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76,204,556 (GRCm39) splice site probably benign
IGL02800:Pcnt APN 10 76,248,417 (GRCm39) nonsense probably null
IGL03395:Pcnt APN 10 76,272,325 (GRCm39) missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76,248,417 (GRCm39) nonsense probably null
PIT4520001:Pcnt UTSW 10 76,256,069 (GRCm39) missense probably damaging 0.99
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0109:Pcnt UTSW 10 76,225,030 (GRCm39) missense probably benign 0.00
R0117:Pcnt UTSW 10 76,244,561 (GRCm39) nonsense probably null
R0254:Pcnt UTSW 10 76,228,414 (GRCm39) missense probably benign 0.10
R0392:Pcnt UTSW 10 76,220,660 (GRCm39) missense probably benign
R0511:Pcnt UTSW 10 76,240,429 (GRCm39) missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76,247,941 (GRCm39) missense probably damaging 1.00
R0614:Pcnt UTSW 10 76,256,150 (GRCm39) missense probably damaging 1.00
R0635:Pcnt UTSW 10 76,240,419 (GRCm39) missense probably damaging 1.00
R0707:Pcnt UTSW 10 76,256,375 (GRCm39) missense probably damaging 1.00
R0749:Pcnt UTSW 10 76,217,198 (GRCm39) missense probably damaging 1.00
R0969:Pcnt UTSW 10 76,263,785 (GRCm39) missense probably damaging 1.00
R1172:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1174:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1175:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1512:Pcnt UTSW 10 76,240,496 (GRCm39) splice site probably null
R1542:Pcnt UTSW 10 76,237,220 (GRCm39) missense probably benign 0.02
R1542:Pcnt UTSW 10 76,225,221 (GRCm39) missense probably benign 0.08
R1558:Pcnt UTSW 10 76,258,756 (GRCm39) missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76,203,164 (GRCm39) missense probably benign 0.02
R1762:Pcnt UTSW 10 76,190,971 (GRCm39) critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76,244,630 (GRCm39) missense probably damaging 0.99
R1869:Pcnt UTSW 10 76,215,740 (GRCm39) missense probably null 0.94
R1911:Pcnt UTSW 10 76,204,650 (GRCm39) missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76,216,171 (GRCm39) missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76,228,633 (GRCm39) nonsense probably null
R2073:Pcnt UTSW 10 76,216,214 (GRCm39) missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2112:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2309:Pcnt UTSW 10 76,278,460 (GRCm39) start gained probably benign
R2902:Pcnt UTSW 10 76,211,064 (GRCm39) missense probably damaging 0.98
R3623:Pcnt UTSW 10 76,269,584 (GRCm39) missense probably benign 0.23
R4088:Pcnt UTSW 10 76,263,848 (GRCm39) missense probably damaging 1.00
R4300:Pcnt UTSW 10 76,203,225 (GRCm39) missense probably benign 0.40
R4402:Pcnt UTSW 10 76,228,227 (GRCm39) missense probably benign 0.00
R4407:Pcnt UTSW 10 76,210,704 (GRCm39) missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76,237,317 (GRCm39) missense probably damaging 1.00
R4647:Pcnt UTSW 10 76,190,047 (GRCm39) missense probably benign 0.01
R4734:Pcnt UTSW 10 76,273,040 (GRCm39) missense probably benign 0.25
R4747:Pcnt UTSW 10 76,272,299 (GRCm39) missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76,245,411 (GRCm39) missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76,205,858 (GRCm39) missense probably benign 0.21
R4831:Pcnt UTSW 10 76,248,335 (GRCm39) missense probably damaging 0.96
R4873:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4875:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4946:Pcnt UTSW 10 76,192,019 (GRCm39) missense probably damaging 1.00
R5032:Pcnt UTSW 10 76,190,911 (GRCm39) missense probably benign 0.00
R5033:Pcnt UTSW 10 76,235,779 (GRCm39) missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76,237,278 (GRCm39) missense probably damaging 1.00
R5118:Pcnt UTSW 10 76,248,002 (GRCm39) missense probably damaging 0.98
R5167:Pcnt UTSW 10 76,256,258 (GRCm39) missense probably damaging 0.97
R5199:Pcnt UTSW 10 76,254,378 (GRCm39) missense probably benign 0.09
R5223:Pcnt UTSW 10 76,216,106 (GRCm39) missense probably damaging 0.99
R5241:Pcnt UTSW 10 76,269,451 (GRCm39) missense probably benign 0.26
R5308:Pcnt UTSW 10 76,192,159 (GRCm39) nonsense probably null
R5328:Pcnt UTSW 10 76,247,553 (GRCm39) missense probably damaging 1.00
R5454:Pcnt UTSW 10 76,225,381 (GRCm39) splice site probably null
R5543:Pcnt UTSW 10 76,247,886 (GRCm39) missense probably benign 0.01
R5588:Pcnt UTSW 10 76,278,445 (GRCm39) missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76,221,675 (GRCm39) missense probably benign 0.17
R5668:Pcnt UTSW 10 76,245,334 (GRCm39) missense probably benign 0.16
R5712:Pcnt UTSW 10 76,265,105 (GRCm39) missense probably damaging 0.96
R5714:Pcnt UTSW 10 76,256,325 (GRCm39) missense probably damaging 1.00
R5797:Pcnt UTSW 10 76,228,590 (GRCm39) missense probably benign 0.00
R5946:Pcnt UTSW 10 76,217,897 (GRCm39) missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76,247,456 (GRCm39) missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76,255,871 (GRCm39) missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R6485:Pcnt UTSW 10 76,225,164 (GRCm39) nonsense probably null
R6605:Pcnt UTSW 10 76,265,032 (GRCm39) critical splice donor site probably null
R6877:Pcnt UTSW 10 76,269,851 (GRCm39) missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76,263,662 (GRCm39) missense probably benign 0.00
R6919:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R7025:Pcnt UTSW 10 76,239,669 (GRCm39) missense probably damaging 1.00
R7098:Pcnt UTSW 10 76,220,673 (GRCm39) missense probably benign
R7109:Pcnt UTSW 10 76,205,738 (GRCm39) missense probably damaging 1.00
R7121:Pcnt UTSW 10 76,263,761 (GRCm39) missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76,224,894 (GRCm39) missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76,247,194 (GRCm39) splice site probably null
R7213:Pcnt UTSW 10 76,244,738 (GRCm39) missense probably damaging 1.00
R7368:Pcnt UTSW 10 76,235,835 (GRCm39) missense probably benign
R7453:Pcnt UTSW 10 76,225,284 (GRCm39) missense probably benign
R7486:Pcnt UTSW 10 76,254,271 (GRCm39) missense probably benign
R7486:Pcnt UTSW 10 76,254,270 (GRCm39) missense probably benign 0.03
R7538:Pcnt UTSW 10 76,235,773 (GRCm39) missense probably benign
R7575:Pcnt UTSW 10 76,225,086 (GRCm39) missense probably benign 0.32
R7662:Pcnt UTSW 10 76,223,356 (GRCm39) missense probably benign 0.27
R7685:Pcnt UTSW 10 76,258,642 (GRCm39) missense probably benign 0.14
R7764:Pcnt UTSW 10 76,190,082 (GRCm39) missense probably benign 0.33
R7802:Pcnt UTSW 10 76,211,137 (GRCm39) splice site probably null
R8432:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8439:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8493:Pcnt UTSW 10 76,239,457 (GRCm39) critical splice donor site probably null
R8530:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8535:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8830:Pcnt UTSW 10 76,218,008 (GRCm39) missense probably benign 0.03
R8878:Pcnt UTSW 10 76,244,675 (GRCm39) missense probably damaging 1.00
R8911:Pcnt UTSW 10 76,223,359 (GRCm39) missense probably damaging 0.98
R8988:Pcnt UTSW 10 76,245,407 (GRCm39) nonsense probably null
R9084:Pcnt UTSW 10 76,235,826 (GRCm39) missense probably benign 0.09
R9169:Pcnt UTSW 10 76,221,572 (GRCm39) missense possibly damaging 0.95
R9372:Pcnt UTSW 10 76,258,960 (GRCm39) missense probably damaging 1.00
R9411:Pcnt UTSW 10 76,258,896 (GRCm39) missense probably damaging 0.96
R9448:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R9479:Pcnt UTSW 10 76,217,963 (GRCm39) missense probably benign 0.00
R9503:Pcnt UTSW 10 76,263,882 (GRCm39) missense possibly damaging 0.59
R9561:Pcnt UTSW 10 76,217,128 (GRCm39) nonsense probably null
R9618:Pcnt UTSW 10 76,188,794 (GRCm39) missense probably damaging 1.00
R9648:Pcnt UTSW 10 76,190,089 (GRCm39) missense probably benign 0.32
R9733:Pcnt UTSW 10 76,237,314 (GRCm39) missense probably benign 0.01
Z1176:Pcnt UTSW 10 76,217,991 (GRCm39) nonsense probably null
Z1177:Pcnt UTSW 10 76,235,802 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTGTTCACGGCATCAATCTC -3'
(R):5'- TCATTGAGAAGCTGCAGAGC -3'

Sequencing Primer
(F):5'- GTTCACGGCATCAATCTCTAAATC -3'
(R):5'- AGAGCGAGCTGAGCCTCATG -3'
Posted On 2022-06-15