Incidental Mutation 'R9459:Slfn14'
ID 714770
Institutional Source Beutler Lab
Gene Symbol Slfn14
Ensembl Gene ENSMUSG00000082101
Gene Name schlafen 14
Synonyms Slfn14-ps, LOC237890
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 83275110-83286726 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 83279372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 482 (Q482P)
Ref Sequence ENSEMBL: ENSMUSP00000139132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163961]
AlphaFold V9GXG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000163961
AA Change: Q482P

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139132
Gene: ENSMUSG00000082101
AA Change: Q482P

DomainStartEndE-ValueType
Pfam:AAA_4 195 329 1e-20 PFAM
low complexity region 539 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in platelet formation and function. Defects in this gene are a cause of thrombocytopenia with excessive bleeding. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Slfn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03214:Slfn14 APN 11 83279000 missense probably benign 0.01
IGL03402:Slfn14 APN 11 83276313 missense probably benign 0.00
R2520:Slfn14 UTSW 11 83276187 missense probably damaging 0.99
R2570:Slfn14 UTSW 11 83283607 missense probably benign 0.02
R3082:Slfn14 UTSW 11 83276693 nonsense probably null
R4611:Slfn14 UTSW 11 83283314 nonsense probably null
R4647:Slfn14 UTSW 11 83276658 missense probably benign 0.01
R4722:Slfn14 UTSW 11 83283418 missense probably benign 0.27
R4833:Slfn14 UTSW 11 83279156 missense probably damaging 1.00
R4876:Slfn14 UTSW 11 83276272 missense possibly damaging 0.87
R5209:Slfn14 UTSW 11 83279633 missense possibly damaging 0.95
R5776:Slfn14 UTSW 11 83283599 missense probably damaging 1.00
R5933:Slfn14 UTSW 11 83279462 missense probably damaging 0.97
R6174:Slfn14 UTSW 11 83276603 missense probably damaging 1.00
R6826:Slfn14 UTSW 11 83281818 critical splice donor site probably null
R7042:Slfn14 UTSW 11 83276604 missense probably damaging 1.00
R7070:Slfn14 UTSW 11 83276705 missense probably benign 0.27
R7191:Slfn14 UTSW 11 83276749 missense probably benign
R7207:Slfn14 UTSW 11 83279388 nonsense probably null
R7297:Slfn14 UTSW 11 83278995 nonsense probably null
R7829:Slfn14 UTSW 11 83281817 critical splice donor site probably null
R8094:Slfn14 UTSW 11 83283293 nonsense probably null
R8263:Slfn14 UTSW 11 83283473 missense possibly damaging 0.90
R8735:Slfn14 UTSW 11 83283889 missense probably damaging 1.00
R8981:Slfn14 UTSW 11 83283629 missense possibly damaging 0.88
R9593:Slfn14 UTSW 11 83283907 missense probably benign 0.02
R9600:Slfn14 UTSW 11 83279222 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTCAGCACAGATCTGGAAC -3'
(R):5'- GACACACCCTTGTTCTCACG -3'

Sequencing Primer
(F):5'- TGGAACACAGTGAGACCAAC -3'
(R):5'- CACGGCATTGTGATATTTTCGAGAAG -3'
Posted On 2022-06-15