Incidental Mutation 'R9459:Cmpk2'
ID 714771
Institutional Source Beutler Lab
Gene Symbol Cmpk2
Ensembl Gene ENSMUSG00000020638
Gene Name cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
Synonyms 1200004E04Rik, Tyki, TDKI
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 26469204-26479837 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 26478023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 413 (T413M)
Ref Sequence ENSEMBL: ENSMUSP00000020969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020969]
AlphaFold Q3U5Q7
Predicted Effect probably damaging
Transcript: ENSMUST00000020969
AA Change: T413M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020969
Gene: ENSMUSG00000020638
AA Change: T413M

DomainStartEndE-ValueType
low complexity region 97 112 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:Thymidylate_kin 257 438 2.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the enzymes in the nucleotide synthesis salvage pathway that may participate in terminal differentiation of monocytic cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Cmpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Cmpk2 APN 12 26477178 missense probably damaging 1.00
IGL03306:Cmpk2 APN 12 26471443 missense possibly damaging 0.77
R0090:Cmpk2 UTSW 12 26478022 missense probably benign 0.00
R0245:Cmpk2 UTSW 12 26469518 missense probably benign 0.01
R0369:Cmpk2 UTSW 12 26477151 nonsense probably null
R0610:Cmpk2 UTSW 12 26478056 missense possibly damaging 0.84
R1370:Cmpk2 UTSW 12 26471452 missense probably damaging 1.00
R1897:Cmpk2 UTSW 12 26474047 missense probably damaging 1.00
R4181:Cmpk2 UTSW 12 26477047 missense probably damaging 0.97
R4210:Cmpk2 UTSW 12 26469571 missense probably benign 0.00
R4544:Cmpk2 UTSW 12 26478017 missense probably damaging 1.00
R5689:Cmpk2 UTSW 12 26469767 missense probably benign 0.10
R6378:Cmpk2 UTSW 12 26469416 missense possibly damaging 0.49
R6383:Cmpk2 UTSW 12 26478020 missense probably benign 0.05
R6597:Cmpk2 UTSW 12 26474145 missense possibly damaging 0.95
R6978:Cmpk2 UTSW 12 26477019 missense probably damaging 1.00
R7332:Cmpk2 UTSW 12 26478062 missense probably damaging 1.00
R8316:Cmpk2 UTSW 12 26474137 missense probably damaging 1.00
R8441:Cmpk2 UTSW 12 26477205 missense probably benign 0.20
R9176:Cmpk2 UTSW 12 26474028 missense probably benign 0.04
R9275:Cmpk2 UTSW 12 26469569 missense probably benign 0.01
R9278:Cmpk2 UTSW 12 26469569 missense probably benign 0.01
R9506:Cmpk2 UTSW 12 26469851 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGCATCACTTCGGACATCATC -3'
(R):5'- CCCTAAATCTAAGAAGCTGCATGG -3'

Sequencing Primer
(F):5'- CGGACATCATCCTTCATTGAAC -3'
(R):5'- TCTAAGAAGCTGCATGGCAAGTG -3'
Posted On 2022-06-15