Mutagenetix > Incidental Mutation

Incidental Mutation 'R9459:Msh3'

714773

Institutional Source

Beutler Lab

Gene Symbol

Msh3

Ensembl Gene

ENSMUSG00000014850

Gene Name

mutS homolog 3

Synonyms

Rep3, Rep-3, D13Em1

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.261) question?

Stock #

R9459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92211872-92355003 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92215539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1036 (V1036A)

Ref Sequence

ENSEMBL: ENSMUSP00000140002 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000190761] [ENSMUST00000191550]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: V1035A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	1.6e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000185852
AA Change: V1036A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: V1036A

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:MutS_I	188	301	7.2e-35	PFAM
Pfam:MutS_II	324	481	2.2e-36	PFAM
MUTSd	513	828	7.62e-97	SMART
MUTSac	847	1049	9.7e-122	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190761

SMART Domains

Protein: ENSMUSP00000140402
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
MUTSac	1	128	2.3e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191550

SMART Domains

Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	T	A	19: 5,503,729	H8L	probably benign	Het
Abcb1a	T	A	5: 8,685,414		probably null	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Aox3	A	G	1: 58,150,309	I390V	probably benign	Het
Ap3b2	T	C	7: 81,473,903	N400S	probably benign	Het
Baalc	A	T	15: 38,934,024	N70I	probably benign	Het
Brca2	T	A	5: 150,540,629	V1286D	probably damaging	Het
Ccdc30	T	C	4: 119,377,273	R81G	possibly damaging	Het
Cd209g	T	C	8: 4,135,610	S15P	probably benign	Het
Chrnb3	G	A	8: 27,393,856	W207*	probably null	Het
Cmpk2	C	T	12: 26,478,023	T413M	probably damaging	Het
Coq4	T	A	2: 29,788,550	Y63N	probably damaging	Het
Depdc5	T	A	5: 32,990,773	S1478T	probably damaging	Het
Etf1	A	G	18: 34,906,081	F378L	probably benign	Het
Exoc6	T	C	19: 37,585,893	V324A	probably benign	Het
Frem2	A	G	3: 53,653,486	L1200P	probably benign	Het
Gadl1	T	C	9: 115,965,611	W285R	probably damaging	Het
Gbp3	A	G	3: 142,564,946		probably null	Het
Gm14295	C	T	2: 176,807,372	T5I	possibly damaging	Het
Hps4	T	C	5: 112,375,009	S578P	probably benign	Het
Kctd13	T	A	7: 126,945,082	D317E	probably damaging	Het
Kdm4b	T	A	17: 56,399,509	D881E	probably benign	Het
Klf10	G	A	15: 38,295,927	P473L	probably damaging	Het
Lrch3	A	T	16: 32,979,405	D371V	probably damaging	Het
Msh2	T	C	17: 87,678,330	S112P	possibly damaging	Het
Mybl1	A	G	1: 9,676,259	V392A	possibly damaging	Het
Myo7a	T	C	7: 98,073,173	I1182V	possibly damaging	Het
Nectin1	A	C	9: 43,803,793	E442A	probably benign	Het
Obsl1	G	T	1: 75,498,240	H839N	probably benign	Het
Olfr1202	T	C	2: 88,817,623	F151L	probably benign	Het
Olfr1505	T	C	19: 13,919,310	C97R	possibly damaging	Het
Pacs1	C	T	19: 5,145,070		probably null	Het
Pcdh17	G	T	14: 84,448,623	E843D	probably benign	Het
Pcnt	A	G	10: 76,392,738	L1531P	probably damaging	Het
Pdgfra	A	G	5: 75,192,468	D973G	probably damaging	Het
Pkd2	A	G	5: 104,466,934	Y214C	probably damaging	Het
Plcb1	T	C	2: 135,322,638	Y427H	probably benign	Het
Ppm1h	A	G	10: 122,907,577	N402S	possibly damaging	Het
Rassf4	T	A	6: 116,641,788		probably null	Het
Ryr1	G	A	7: 29,068,643	T2856I	probably damaging	Het
Serpinb8	A	T	1: 107,605,790	K192*	probably null	Het
Slfn14	T	G	11: 83,279,372	Q482P	possibly damaging	Het
Spata2	A	G	2: 167,485,285	V64A	probably benign	Het
Tax1bp1	T	G	6: 52,729,329	V105G	probably damaging	Het
Tbc1d22a	T	G	15: 86,235,820	S142A	possibly damaging	Het
Tdrd9	T	C	12: 112,025,573	F594S	probably damaging	Het
Uba3	T	C	6: 97,189,598	I281V	probably benign	Het
Uggt2	T	C	14: 119,049,183	E723G	probably benign	Het
Usp20	C	T	2: 31,011,012	S391F	probably damaging	Het
Usp24	T	A	4: 106,342,358	D166E	probably damaging	Het
Vmn1r1	A	G	1: 182,157,938	V54A	probably benign	Het
Zfp442	T	A	2: 150,408,748	E411D	unknown	Het
Zfp804a	T	C	2: 82,259,409	I1194T	probably damaging	Het

Other mutations in Msh3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Msh3	APN	13	92344964	missense	probably damaging	1.00
IGL00983:Msh3	APN	13	92300277	missense	probably damaging	1.00
IGL01490:Msh3	APN	13	92300305	missense	probably damaging	1.00
IGL02072:Msh3	APN	13	92300295	missense	probably damaging	1.00
IGL02313:Msh3	APN	13	92349312	missense	possibly damaging	0.86
IGL02711:Msh3	APN	13	92351311	missense	probably damaging	1.00
IGL03108:Msh3	APN	13	92221088	splice site	probably benign
IGL03227:Msh3	APN	13	92285960	missense	probably damaging	0.98
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0164:Msh3	UTSW	13	92349209	missense	probably damaging	1.00
R0415:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
R0457:Msh3	UTSW	13	92220997	missense	probably damaging	1.00
R0659:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0661:Msh3	UTSW	13	92345096	missense	possibly damaging	0.80
R0686:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0688:Msh3	UTSW	13	92351431	missense	possibly damaging	0.53
R0707:Msh3	UTSW	13	92347340	nonsense	probably null
R1605:Msh3	UTSW	13	92300275	missense	probably null	1.00
R1622:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R1771:Msh3	UTSW	13	92212496	missense	probably benign	0.05
R1970:Msh3	UTSW	13	92249820	splice site	probably benign
R1971:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R1971:Msh3	UTSW	13	92249820	splice site	probably benign
R2894:Msh3	UTSW	13	92342360	missense	probably benign	0.16
R3837:Msh3	UTSW	13	92354858	missense	probably damaging	1.00
R4119:Msh3	UTSW	13	92354011	intron	probably benign
R4225:Msh3	UTSW	13	92285923	missense	probably benign	0.03
R4881:Msh3	UTSW	13	92266041	intron	probably benign
R5118:Msh3	UTSW	13	92309434	splice site	probably benign
R5209:Msh3	UTSW	13	92344954	critical splice donor site	probably null
R5817:Msh3	UTSW	13	92286000	missense	possibly damaging	0.86
R5849:Msh3	UTSW	13	92249878	missense	possibly damaging	0.81
R5851:Msh3	UTSW	13	92215522	missense	probably benign	0.00
R5940:Msh3	UTSW	13	92249843	missense	probably damaging	1.00
R6004:Msh3	UTSW	13	92342414	critical splice acceptor site	probably null
R6363:Msh3	UTSW	13	92212524	missense	probably damaging	1.00
R6510:Msh3	UTSW	13	92353264	nonsense	probably null
R6654:Msh3	UTSW	13	92345042	missense	probably benign	0.01
R6853:Msh3	UTSW	13	92312572	critical splice donor site	probably null
R7022:Msh3	UTSW	13	92235588	missense	probably damaging	1.00
R7098:Msh3	UTSW	13	92274111	missense	possibly damaging	0.95
R7103:Msh3	UTSW	13	92274800	missense	probably benign
R7148:Msh3	UTSW	13	92354822	missense	probably benign	0.18
R7171:Msh3	UTSW	13	92349298	missense	probably benign	0.00
R7317:Msh3	UTSW	13	92286004	missense	probably damaging	1.00
R7369:Msh3	UTSW	13	92299262	missense	probably benign	0.15
R7586:Msh3	UTSW	13	92349332	utr 3 prime	probably benign
R7641:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R7648:Msh3	UTSW	13	92274028	missense	probably damaging	1.00
R7674:Msh3	UTSW	13	92212503	missense	probably benign	0.08
R8125:Msh3	UTSW	13	92299182	missense	probably benign
R8252:Msh3	UTSW	13	92221061	missense	probably damaging	1.00
R8388:Msh3	UTSW	13	92223276	missense	probably damaging	1.00
R8442:Msh3	UTSW	13	92212512	missense	probably benign	0.00
R8735:Msh3	UTSW	13	92274866	missense	possibly damaging	0.94
R8986:Msh3	UTSW	13	92346826	missense	probably damaging	1.00
R9264:Msh3	UTSW	13	92349304	missense	probably benign	0.00
R9326:Msh3	UTSW	13	92263799	missense	probably benign	0.15
R9457:Msh3	UTSW	13	92345086	missense	probably benign	0.04
R9648:Msh3	UTSW	13	92342249	missense	probably benign	0.00
S24628:Msh3	UTSW	13	92346786	missense	possibly damaging	0.89
X0027:Msh3	UTSW	13	92274070	missense	probably damaging	0.98
X0063:Msh3	UTSW	13	92274785	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAAGCTGCACTCCAGAG -3'
(R):5'- TTTAGACCATTCCCCTGAACAGAG -3'

Sequencing Primer
(F):5'- TGCACTCCAGAGGCACTG -3'
(R):5'- TGAACAGAGGCCGTGCG -3'

Posted On

2022-06-15