Incidental Mutation 'R9459:Tbc1d22a'
ID 714778
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene Name TBC1 domain family, member 22a
Synonyms D15Ertd781e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 86214459-86498503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 86235820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 142 (S142A)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414] [ENSMUST00000229242]
AlphaFold Q8R5A6
Predicted Effect possibly damaging
Transcript: ENSMUST00000063414
AA Change: S142A

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: S142A

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000229242
AA Change: S106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86301555 missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86391203 missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86299669 missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86239171 missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86299684 missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86292134 missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86496826 missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86351651 splice site probably null
R1703:Tbc1d22a UTSW 15 86239215 missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86239149 missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86391065 splice site probably null
R4380:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86235685 missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86311836 missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86496916 missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86311748 missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86391086 missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86351728 missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86214608 missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86214629 missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86301567 missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86239155 missense probably benign 0.07
R7294:Tbc1d22a UTSW 15 86311835 missense possibly damaging 0.90
R7645:Tbc1d22a UTSW 15 86235541 missense probably benign 0.01
R7704:Tbc1d22a UTSW 15 86366675 missense probably damaging 1.00
R9204:Tbc1d22a UTSW 15 86214602 missense probably benign 0.15
R9370:Tbc1d22a UTSW 15 86239240 missense probably benign 0.00
R9792:Tbc1d22a UTSW 15 86235638 missense probably damaging 0.99
R9793:Tbc1d22a UTSW 15 86235638 missense probably damaging 0.99
RF013:Tbc1d22a UTSW 15 86299774 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGATGAGCTCCTGGCCATG -3'
(R):5'- AGCCTGGTCCCCAAATAAAG -3'

Sequencing Primer
(F):5'- GGCGACAGAGAGCCTGAACTC -3'
(R):5'- AGACCATCTGGAGCCCACG -3'
Posted On 2022-06-15