Incidental Mutation 'R9459:Msh2'
ID 714781
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene Name mutS homolog 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 87672330-87723713 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87678330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
AlphaFold P43247
Predicted Effect possibly damaging
Transcript: ENSMUST00000024967
AA Change: S112P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: S112P

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151
AA Change: S107P

DomainStartEndE-ValueType
Pfam:MutS_I 13 129 3.8e-22 PFAM
Pfam:MutS_II 103 193 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Serpinb8 A T 1: 107,605,790 K192* probably null Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 splice site probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4589:Msh2 UTSW 17 87680032 missense possibly damaging 0.67
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4599:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5014:Msh2 UTSW 17 87717576 missense possibly damaging 0.83
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
R7260:Msh2 UTSW 17 87717619 missense probably damaging 0.97
R7358:Msh2 UTSW 17 87717529 missense possibly damaging 0.89
R9197:Msh2 UTSW 17 87719515 missense possibly damaging 0.79
R9227:Msh2 UTSW 17 87719289 missense probably benign 0.10
R9230:Msh2 UTSW 17 87719289 missense probably benign 0.10
R9799:Msh2 UTSW 17 87717505 missense probably damaging 1.00
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTATTACCTCACAGCCTCATC -3'
(R):5'- AAGGTTTGGCGTGTTCAAAAC -3'

Sequencing Primer
(F):5'- ATTACCTCACAGCCTCATCTTTAAC -3'
(R):5'- GGCATTTTGCTATCACAACC -3'
Posted On 2022-06-15