Mutagenetix > Incidental Mutation

Incidental Mutation 'R9459:Msh2'

714781

Institutional Source

Beutler Lab

Gene Symbol

Msh2

Ensembl Gene

ENSMUSG00000024151

Gene Name

mutS homolog 2

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.803) question?

Stock #

R9459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87672330-87723713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87678330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 112 (S112P)

Ref Sequence

ENSEMBL: ENSMUSP00000024967 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024967]

AlphaFold

P43247

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024967
AA Change: S112P

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: S112P

Domain	Start	End	E-Value	Type
Pfam:MutS_I	17	132	4.6e-22	PFAM
Pfam:MutS_II	150	290	6.7e-23	PFAM
MUTSd	321	645	1e-105	SMART
MUTSac	662	849	3.54e-124	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151
AA Change: S107P

Domain	Start	End	E-Value	Type
Pfam:MutS_I	13	129	3.8e-22	PFAM
Pfam:MutS_II	103	193	2.5e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	T	A	19: 5,503,729	H8L	probably benign	Het
Abcb1a	T	A	5: 8,685,414		probably null	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Aox3	A	G	1: 58,150,309	I390V	probably benign	Het
Ap3b2	T	C	7: 81,473,903	N400S	probably benign	Het
Baalc	A	T	15: 38,934,024	N70I	probably benign	Het
Brca2	T	A	5: 150,540,629	V1286D	probably damaging	Het
Ccdc30	T	C	4: 119,377,273	R81G	possibly damaging	Het
Cd209g	T	C	8: 4,135,610	S15P	probably benign	Het
Chrnb3	G	A	8: 27,393,856	W207*	probably null	Het
Cmpk2	C	T	12: 26,478,023	T413M	probably damaging	Het
Coq4	T	A	2: 29,788,550	Y63N	probably damaging	Het
Depdc5	T	A	5: 32,990,773	S1478T	probably damaging	Het
Etf1	A	G	18: 34,906,081	F378L	probably benign	Het
Exoc6	T	C	19: 37,585,893	V324A	probably benign	Het
Frem2	A	G	3: 53,653,486	L1200P	probably benign	Het
Gadl1	T	C	9: 115,965,611	W285R	probably damaging	Het
Gbp3	A	G	3: 142,564,946		probably null	Het
Gm14295	C	T	2: 176,807,372	T5I	possibly damaging	Het
Hps4	T	C	5: 112,375,009	S578P	probably benign	Het
Kctd13	T	A	7: 126,945,082	D317E	probably damaging	Het
Kdm4b	T	A	17: 56,399,509	D881E	probably benign	Het
Klf10	G	A	15: 38,295,927	P473L	probably damaging	Het
Lrch3	A	T	16: 32,979,405	D371V	probably damaging	Het
Msh3	A	G	13: 92,215,539	V1036A	possibly damaging	Het
Mybl1	A	G	1: 9,676,259	V392A	possibly damaging	Het
Myo7a	T	C	7: 98,073,173	I1182V	possibly damaging	Het
Nectin1	A	C	9: 43,803,793	E442A	probably benign	Het
Obsl1	G	T	1: 75,498,240	H839N	probably benign	Het
Olfr1202	T	C	2: 88,817,623	F151L	probably benign	Het
Olfr1505	T	C	19: 13,919,310	C97R	possibly damaging	Het
Pacs1	C	T	19: 5,145,070		probably null	Het
Pcdh17	G	T	14: 84,448,623	E843D	probably benign	Het
Pcnt	A	G	10: 76,392,738	L1531P	probably damaging	Het
Pdgfra	A	G	5: 75,192,468	D973G	probably damaging	Het
Pkd2	A	G	5: 104,466,934	Y214C	probably damaging	Het
Plcb1	T	C	2: 135,322,638	Y427H	probably benign	Het
Ppm1h	A	G	10: 122,907,577	N402S	possibly damaging	Het
Rassf4	T	A	6: 116,641,788		probably null	Het
Ryr1	G	A	7: 29,068,643	T2856I	probably damaging	Het
Serpinb8	A	T	1: 107,605,790	K192*	probably null	Het
Slfn14	T	G	11: 83,279,372	Q482P	possibly damaging	Het
Spata2	A	G	2: 167,485,285	V64A	probably benign	Het
Tax1bp1	T	G	6: 52,729,329	V105G	probably damaging	Het
Tbc1d22a	T	G	15: 86,235,820	S142A	possibly damaging	Het
Tdrd9	T	C	12: 112,025,573	F594S	probably damaging	Het
Uba3	T	C	6: 97,189,598	I281V	probably benign	Het
Uggt2	T	C	14: 119,049,183	E723G	probably benign	Het
Usp20	C	T	2: 31,011,012	S391F	probably damaging	Het
Usp24	T	A	4: 106,342,358	D166E	probably damaging	Het
Vmn1r1	A	G	1: 182,157,938	V54A	probably benign	Het
Zfp442	T	A	2: 150,408,748	E411D	unknown	Het
Zfp804a	T	C	2: 82,259,409	I1194T	probably damaging	Het

Other mutations in Msh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01405:Msh2	APN	17	87678235	missense	probably damaging	1.00
IGL01602:Msh2	APN	17	87696489	unclassified	probably benign
IGL01605:Msh2	APN	17	87696489	unclassified	probably benign
IGL01775:Msh2	APN	17	87682646	missense	possibly damaging	0.94
IGL02243:Msh2	APN	17	87678368	splice site	probably benign
IGL02524:Msh2	APN	17	87678357	missense	probably benign	0.01
IGL02730:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL02743:Msh2	APN	17	87707215	missense	probably damaging	1.00
IGL03049:Msh2	APN	17	87708509	missense	probably damaging	1.00
IGL03282:Msh2	APN	17	87689002	missense	probably benign	0.00
IGL03286:Msh2	APN	17	87682667	missense	possibly damaging	0.92
R0011:Msh2	UTSW	17	87680093	intron	probably benign
R0363:Msh2	UTSW	17	87717476	missense	probably benign	0.30
R0520:Msh2	UTSW	17	87717544	missense	possibly damaging	0.77
R0633:Msh2	UTSW	17	87672810	splice site	probably null
R0862:Msh2	UTSW	17	87680052	missense	probably benign
R0864:Msh2	UTSW	17	87680052	missense	probably benign
R1146:Msh2	UTSW	17	87680060	missense	probably benign	0.00
R1146:Msh2	UTSW	17	87680060	missense	probably benign	0.00
R1264:Msh2	UTSW	17	87707179	splice site	probably null
R1459:Msh2	UTSW	17	87678343	missense	probably benign	0.01
R1572:Msh2	UTSW	17	87718652	missense	possibly damaging	0.89
R1592:Msh2	UTSW	17	87680013	splice site	probably null
R1647:Msh2	UTSW	17	87672636	missense	probably benign
R1984:Msh2	UTSW	17	87719296	missense	probably damaging	1.00
R2298:Msh2	UTSW	17	87708502	missense	probably damaging	0.99
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R2871:Msh2	UTSW	17	87685584	missense	possibly damaging	0.61
R4383:Msh2	UTSW	17	87689138	missense	probably benign	0.00
R4411:Msh2	UTSW	17	87717604	missense	probably damaging	0.97
R4589:Msh2	UTSW	17	87680032	missense	possibly damaging	0.67
R4598:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4599:Msh2	UTSW	17	87708578	missense	probably damaging	1.00
R4712:Msh2	UTSW	17	87678385	intron	probably benign
R4714:Msh2	UTSW	17	87718789	missense	probably damaging	1.00
R4834:Msh2	UTSW	17	87723413	missense	probably benign
R4842:Msh2	UTSW	17	87723413	missense	probably benign
R4859:Msh2	UTSW	17	87718759	missense	possibly damaging	0.94
R5007:Msh2	UTSW	17	87723413	missense	probably benign
R5008:Msh2	UTSW	17	87723413	missense	probably benign
R5010:Msh2	UTSW	17	87723413	missense	probably benign
R5014:Msh2	UTSW	17	87717576	missense	possibly damaging	0.83
R5048:Msh2	UTSW	17	87672768	missense	probably damaging	1.00
R5133:Msh2	UTSW	17	87723413	missense	probably benign
R5162:Msh2	UTSW	17	87723413	missense	probably benign
R5163:Msh2	UTSW	17	87723413	missense	probably benign
R5183:Msh2	UTSW	17	87723413	missense	probably benign
R5184:Msh2	UTSW	17	87723413	missense	probably benign
R5597:Msh2	UTSW	17	87723361	missense	probably benign	0.04
R5655:Msh2	UTSW	17	87719443	missense	possibly damaging	0.82
R5973:Msh2	UTSW	17	87708583	missense	probably damaging	1.00
R6191:Msh2	UTSW	17	87723472	missense	probably benign	0.03
R6632:Msh2	UTSW	17	87712666	missense	possibly damaging	0.49
R7260:Msh2	UTSW	17	87717619	missense	probably damaging	0.97
R7358:Msh2	UTSW	17	87717529	missense	possibly damaging	0.89
R9197:Msh2	UTSW	17	87719515	missense	possibly damaging	0.79
R9227:Msh2	UTSW	17	87719289	missense	probably benign	0.10
R9230:Msh2	UTSW	17	87719289	missense	probably benign	0.10
R9799:Msh2	UTSW	17	87717505	missense	probably damaging	1.00
X0058:Msh2	UTSW	17	87679934	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATGTATTACCTCACAGCCTCATC -3'
(R):5'- AAGGTTTGGCGTGTTCAAAAC -3'

Sequencing Primer
(F):5'- ATTACCTCACAGCCTCATCTTTAAC -3'
(R):5'- GGCATTTTGCTATCACAACC -3'

Posted On

2022-06-15