Incidental Mutation 'R9459:Pacs1'
ID 714783
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5183714-5323138 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 5195098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786] [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably null
Transcript: ENSMUST00000025786
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025786
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5,203,726 (GRCm39) missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5,192,660 (GRCm39) missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5,218,000 (GRCm39) missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5,185,033 (GRCm39) missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5,185,138 (GRCm39) splice site probably benign
Batavian UTSW 19 5,206,441 (GRCm39) missense possibly damaging 0.71
chicory UTSW 19 5,189,325 (GRCm39) missense probably benign 0.33
endive UTSW 19 5,322,611 (GRCm39) nonsense probably null
Escarole UTSW 19 5,206,384 (GRCm39) critical splice donor site probably null
frisee UTSW 19 5,186,819 (GRCm39) missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5,206,402 (GRCm39) missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5,206,402 (GRCm39) missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5,185,149 (GRCm39) splice site silent
R0369:Pacs1 UTSW 19 5,191,726 (GRCm39) missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5,322,611 (GRCm39) nonsense probably null
R0973:Pacs1 UTSW 19 5,193,857 (GRCm39) missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5,193,857 (GRCm39) missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5,193,857 (GRCm39) missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5,185,265 (GRCm39) missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5,202,337 (GRCm39) missense probably benign 0.00
R1689:Pacs1 UTSW 19 5,322,643 (GRCm39) unclassified probably benign
R1842:Pacs1 UTSW 19 5,205,912 (GRCm39) missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5,203,742 (GRCm39) missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5,205,787 (GRCm39) missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5,193,861 (GRCm39) nonsense probably null
R4630:Pacs1 UTSW 19 5,206,384 (GRCm39) critical splice donor site probably null
R5029:Pacs1 UTSW 19 5,192,299 (GRCm39) missense probably benign 0.03
R5198:Pacs1 UTSW 19 5,189,325 (GRCm39) missense probably benign 0.33
R5223:Pacs1 UTSW 19 5,195,169 (GRCm39) missense probably benign 0.00
R5464:Pacs1 UTSW 19 5,197,235 (GRCm39) missense probably benign
R5695:Pacs1 UTSW 19 5,186,819 (GRCm39) missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5,202,400 (GRCm39) splice site probably null
R6335:Pacs1 UTSW 19 5,210,005 (GRCm39) missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5,202,812 (GRCm39) missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5,210,823 (GRCm39) missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5,206,402 (GRCm39) missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5,206,441 (GRCm39) missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5,189,003 (GRCm39) missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5,195,148 (GRCm39) missense probably benign 0.09
R7682:Pacs1 UTSW 19 5,202,727 (GRCm39) missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5,191,709 (GRCm39) missense probably benign 0.01
R7738:Pacs1 UTSW 19 5,202,378 (GRCm39) missense probably benign 0.11
R8339:Pacs1 UTSW 19 5,192,651 (GRCm39) missense probably damaging 1.00
R8930:Pacs1 UTSW 19 5,185,030 (GRCm39) missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5,185,030 (GRCm39) missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5,188,964 (GRCm39) missense probably benign 0.23
R9211:Pacs1 UTSW 19 5,189,057 (GRCm39) missense probably damaging 0.99
R9584:Pacs1 UTSW 19 5,322,622 (GRCm39) missense probably benign
R9608:Pacs1 UTSW 19 5,193,862 (GRCm39) missense probably damaging 1.00
R9732:Pacs1 UTSW 19 5,184,997 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTGGTTCTCTCACTCAG -3'
(R):5'- AGACTCCTGCAGTTATCAAGTAAGAG -3'

Sequencing Primer
(F):5'- TCTCACTCAGGGGCTTGGAG -3'
(R):5'- CCTGCAGTTATCAAGTAAGAGGTAAC -3'
Posted On 2022-06-15