Incidental Mutation 'R9459:Nscme3l'
ID 714784
Institutional Source Beutler Lab
Gene Symbol Nscme3l
Ensembl Gene ENSMUSG00000100937
Gene Name NSE3 homolog, SMC5-SMC6 complex component like
Synonyms 1700020D05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5552795-5553815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5553757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 8 (H8L)
Ref Sequence ENSEMBL: ENSMUSP00000140922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070172] [ENSMUST00000189704]
AlphaFold Q99PB1
Predicted Effect probably benign
Transcript: ENSMUST00000070172
SMART Domains Protein: ENSMUSP00000070915
Gene: ENSMUSG00000056185

DomainStartEndE-ValueType
Pfam:PX 24 165 1.4e-19 PFAM
Pfam:Vps5 183 394 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189704
AA Change: H8L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140922
Gene: ENSMUSG00000100937
AA Change: H8L

DomainStartEndE-ValueType
Pfam:MAGE 82 253 2.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Nscme3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Nscme3l APN 19 5,553,209 (GRCm39) missense possibly damaging 0.46
IGL03285:Nscme3l APN 19 5,553,205 (GRCm39) missense probably damaging 1.00
R4445:Nscme3l UTSW 19 5,553,022 (GRCm39) missense probably damaging 1.00
R4804:Nscme3l UTSW 19 5,553,028 (GRCm39) missense possibly damaging 0.82
R5449:Nscme3l UTSW 19 5,553,292 (GRCm39) missense probably benign 0.44
R5542:Nscme3l UTSW 19 5,553,463 (GRCm39) missense probably damaging 0.99
R6435:Nscme3l UTSW 19 5,553,446 (GRCm39) missense probably benign 0.06
R6476:Nscme3l UTSW 19 5,553,253 (GRCm39) missense probably damaging 1.00
R6764:Nscme3l UTSW 19 5,552,900 (GRCm39) missense probably damaging 1.00
R7102:Nscme3l UTSW 19 5,553,623 (GRCm39) missense probably benign 0.00
R7232:Nscme3l UTSW 19 5,553,659 (GRCm39) missense possibly damaging 0.87
R7541:Nscme3l UTSW 19 5,553,439 (GRCm39) missense probably benign 0.40
R7640:Nscme3l UTSW 19 5,553,035 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCTCTGCCACCTTAAG -3'
(R):5'- TTGAAACTAGCCAAGAAGATCCAG -3'

Sequencing Primer
(F):5'- AGCTGCTTCTGGGTCCAG -3'
(R):5'- GAAGATCCAGCACAAATCCAACTAGG -3'
Posted On 2022-06-15