Incidental Mutation 'R9459:Exoc6'
ID 714786
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Name exocyst complex component 6
Synonyms msec15, 4833405E05Rik, hbd, Sec15l1, Sec15
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 37525181-37672499 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37574341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 324 (V324A)
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066439
AA Change: V324A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: V324A

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37,578,324 (GRCm39) missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37,671,412 (GRCm39) missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37,597,402 (GRCm39) missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37,566,922 (GRCm39) missense probably benign
IGL03394:Exoc6 APN 19 37,588,020 (GRCm39) missense probably benign 0.15
australamerican UTSW 19 37,587,127 (GRCm39) critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37,582,217 (GRCm39) critical splice donor site probably null
R1156:Exoc6 UTSW 19 37,671,345 (GRCm39) missense probably benign 0.05
R1489:Exoc6 UTSW 19 37,585,568 (GRCm39) missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37,628,217 (GRCm39) splice site probably null
R2125:Exoc6 UTSW 19 37,579,389 (GRCm39) missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37,641,861 (GRCm39) missense probably benign 0.34
R4090:Exoc6 UTSW 19 37,560,360 (GRCm39) missense probably benign
R4666:Exoc6 UTSW 19 37,558,953 (GRCm39) missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37,597,530 (GRCm39) missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37,587,127 (GRCm39) critical splice donor site probably null
R5471:Exoc6 UTSW 19 37,588,065 (GRCm39) missense probably benign 0.30
R5533:Exoc6 UTSW 19 37,582,218 (GRCm39) splice site probably null
R5607:Exoc6 UTSW 19 37,566,977 (GRCm39) missense probably benign 0.01
R5641:Exoc6 UTSW 19 37,576,081 (GRCm39) splice site probably null
R5759:Exoc6 UTSW 19 37,562,189 (GRCm39) nonsense probably null
R5889:Exoc6 UTSW 19 37,570,693 (GRCm39) missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37,560,360 (GRCm39) missense probably benign
R6936:Exoc6 UTSW 19 37,560,311 (GRCm39) missense probably benign 0.00
R6988:Exoc6 UTSW 19 37,597,539 (GRCm39) missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37,565,458 (GRCm39) missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37,565,566 (GRCm39) missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37,565,422 (GRCm39) missense probably benign 0.00
R8266:Exoc6 UTSW 19 37,565,497 (GRCm39) missense probably benign 0.00
R8525:Exoc6 UTSW 19 37,597,440 (GRCm39) missense possibly damaging 0.53
R8917:Exoc6 UTSW 19 37,578,360 (GRCm39) missense probably benign 0.35
R9003:Exoc6 UTSW 19 37,587,097 (GRCm39) missense probably damaging 1.00
R9159:Exoc6 UTSW 19 37,597,478 (GRCm39) missense probably benign 0.00
R9435:Exoc6 UTSW 19 37,585,545 (GRCm39) missense probably benign 0.00
R9527:Exoc6 UTSW 19 37,558,987 (GRCm39) missense probably benign 0.26
R9563:Exoc6 UTSW 19 37,588,071 (GRCm39) missense probably damaging 1.00
R9730:Exoc6 UTSW 19 37,588,032 (GRCm39) missense probably benign 0.02
RF009:Exoc6 UTSW 19 37,560,068 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGATGTCTGTCTCAGCAG -3'
(R):5'- TGCACAGTTCACCATATAGTCAGAAAC -3'

Sequencing Primer
(F):5'- TCTGTCTCAGCAGGGGCAG -3'
(R):5'- CAGTGTCTGTCTTTCCTAACAGAATG -3'
Posted On 2022-06-15