Incidental Mutation 'R9460:Cramp1'
ID 714838
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9460 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25222281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 146 (S146P)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: S146P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: S146P

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 C T 17: 57,183,316 (GRCm39) T19I probably damaging Het
Alg1 T A 16: 5,060,425 (GRCm39) M382K probably damaging Het
Arhgap17 A G 7: 122,879,286 (GRCm39) S822P unknown Het
Bend7 A C 2: 4,749,302 (GRCm39) T140P probably benign Het
C1rb T G 6: 124,557,865 (GRCm39) D667E probably benign Het
Carmil1 A G 13: 24,253,750 (GRCm39) C794R probably damaging Het
Cd36 T C 5: 18,000,608 (GRCm39) D365G probably null Het
Cep164 T C 9: 45,685,282 (GRCm39) N825S probably benign Het
Cp T C 3: 20,018,566 (GRCm39) L90P Het
Cpeb2 C T 5: 43,390,769 (GRCm39) probably benign Het
Csmd3 A T 15: 47,617,130 (GRCm39) D1019E Het
Cyp2d10 T A 15: 82,289,470 (GRCm39) D214V probably benign Het
Dcaf17 G C 2: 70,917,695 (GRCm39) V406L possibly damaging Het
Ehmt1 A G 2: 24,728,791 (GRCm39) V703A probably benign Het
Ermp1 A C 19: 29,609,916 (GRCm39) V293G probably benign Het
Fancd2os C A 6: 113,574,569 (GRCm39) V146F probably benign Het
Galnt12 C T 4: 47,117,983 (GRCm39) T426I probably damaging Het
Gm11011 T A 2: 169,429,289 (GRCm39) T44S unknown Het
Gm2832 C T 14: 41,000,843 (GRCm39) T27I Het
Klhl32 A G 4: 24,649,866 (GRCm39) V310A probably benign Het
Kntc1 T A 5: 123,941,378 (GRCm39) C1728* probably null Het
Lama2 T A 10: 27,298,475 (GRCm39) N207I probably damaging Het
Lpar5 A G 6: 125,058,234 (GRCm39) probably benign Het
Map3k8 T C 18: 4,349,277 (GRCm39) I14V probably benign Het
Marf1 A T 16: 13,947,526 (GRCm39) V1151E probably damaging Het
Me1 G A 9: 86,495,685 (GRCm39) A274V probably damaging Het
Mybpc1 A T 10: 88,372,197 (GRCm39) I797N probably damaging Het
Myo15a T A 11: 60,372,566 (GRCm39) probably null Het
N4bp2 A T 5: 65,963,886 (GRCm39) D645V probably benign Het
Nlrp4f G T 13: 65,342,006 (GRCm39) D546E possibly damaging Het
Npc1 T C 18: 12,346,398 (GRCm39) D266G possibly damaging Het
Or4a81 G A 2: 89,618,778 (GRCm39) S306L probably benign Het
Or8k16 A G 2: 85,520,359 (GRCm39) I195M probably benign Het
Pcdha12 C T 18: 37,153,574 (GRCm39) R98W probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pigr T C 1: 130,772,403 (GRCm39) I207T probably damaging Het
Plxnc1 T A 10: 94,700,895 (GRCm39) E596D probably benign Het
Polr1e C T 4: 45,018,691 (GRCm39) P7L probably benign Het
Ppp5c G T 7: 16,741,137 (GRCm39) Y313* probably null Het
Sacs C A 14: 61,441,611 (GRCm39) T1219K probably benign Het
Scn3a A G 2: 65,300,535 (GRCm39) V1277A probably damaging Het
Serinc5 G T 13: 92,844,607 (GRCm39) A450S possibly damaging Het
Serinc5 T C 13: 92,844,619 (GRCm39) C454R probably benign Het
Slc12a6 G A 2: 112,183,280 (GRCm39) V771I probably benign Het
Slc4a1ap T C 5: 31,685,463 (GRCm39) I247T probably benign Het
Snx10 T A 6: 51,565,888 (GRCm39) S184R probably damaging Het
Tgm2 A T 2: 157,971,241 (GRCm39) probably null Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Thsd7b T C 1: 130,090,674 (GRCm39) probably null Het
Tiam2 G A 17: 3,487,585 (GRCm39) G702E probably damaging Het
Tmco4 T A 4: 138,747,387 (GRCm39) V212D probably damaging Het
Usp48 G A 4: 137,340,996 (GRCm39) G332E probably benign Het
Vipas39 A G 12: 87,288,021 (GRCm39) L482P probably damaging Het
Vmn1r5 T A 6: 56,962,829 (GRCm39) M168K Het
Vps13c T C 9: 67,837,904 (GRCm39) L1818S possibly damaging Het
Vwa2 A G 19: 56,886,388 (GRCm39) I152V probably benign Het
Zfp180 G A 7: 23,804,399 (GRCm39) G273R probably damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGGATCCTTGAGAAAATCTGCC -3'
(R):5'- GTGGCAGTGAACACTTGGTG -3'

Sequencing Primer
(F):5'- TCTGCCTAATTAACAGCAATGCAG -3'
(R):5'- AGTGAACACTTGGTGCCCCTC -3'
Posted On 2022-06-15