Incidental Mutation 'R9461:Ccdc190'
ID 714847
Institutional Source Beutler Lab
Gene Symbol Ccdc190
Ensembl Gene ENSMUSG00000070532
Gene Name coiled-coil domain containing 190
Synonyms 1700084C01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9461 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 169928648-169934653 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 169933920 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 197 (G197D)
Ref Sequence ENSEMBL: ENSMUSP00000135819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094348] [ENSMUST00000175731]
AlphaFold Q3URK1
Predicted Effect probably benign
Transcript: ENSMUST00000094348
AA Change: G196D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091908
Gene: ENSMUSG00000070532
AA Change: G196D

DomainStartEndE-ValueType
coiled coil region 40 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175731
AA Change: G197D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135819
Gene: ENSMUSG00000070532
AA Change: G197D

DomainStartEndE-ValueType
Pfam:DUF4697 8 275 1.4e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abhd18 A T 3: 40,904,884 probably null Het
Aox1 G A 1: 58,077,577 probably null Het
Arpp21 C A 9: 112,136,636 R422L probably damaging Het
Cdc42bpa G T 1: 180,142,296 L1243F probably damaging Het
Ces2b T A 8: 104,837,379 F462I probably benign Het
Cfap45 A G 1: 172,535,327 E295G possibly damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col24a1 G T 3: 145,481,124 E1227* probably null Het
Col5a1 A T 2: 28,032,604 D1717V unknown Het
Dab2 T C 15: 6,430,954 S448P possibly damaging Het
Dnajb1 T C 8: 83,608,544 probably null Het
Dock9 C T 14: 121,605,189 G1223D probably benign Het
Elp2 A G 18: 24,632,812 R670G probably damaging Het
Eppk1 T C 15: 76,110,468 I738V probably benign Het
Gas2l2 T A 11: 83,422,205 R760S probably damaging Het
Gm7534 G A 4: 134,202,001 P331L probably benign Het
H1fnt C T 15: 98,257,257 A4T probably damaging Het
Kif17 G A 4: 138,277,942 V273I probably damaging Het
Klhdc4 T C 8: 121,799,485 D336G probably damaging Het
Lmod2 A G 6: 24,603,569 N181S probably benign Het
Lrp8 G A 4: 107,843,318 G151D possibly damaging Het
Mb21d2 C T 16: 28,828,509 V238M probably damaging Het
Mfsd4b3 T G 10: 39,947,251 I338L probably benign Het
Nkain2 C T 10: 32,890,129 A112T unknown Het
Olfr1445 T A 19: 12,884,511 V210E possibly damaging Het
Olfr152 A G 2: 87,782,539 I2V probably benign Het
Olfr295 T A 7: 86,586,039 Y255N possibly damaging Het
Olfr667 T A 7: 104,916,376 I307F probably benign Het
Pacs2 A G 12: 113,047,107 I126V probably benign Het
Phyhipl T C 10: 70,559,413 Y321C possibly damaging Het
Ppm1k T C 6: 57,510,735 S368G probably damaging Het
Ranbp6 T C 19: 29,809,763 D1063G possibly damaging Het
Sars2 T C 7: 28,750,013 M322T probably benign Het
Serbp1 G A 6: 67,267,329 R78H probably benign Het
Sfxn2 T A 19: 46,585,753 N127K probably damaging Het
Sgsm1 A T 5: 113,276,032 probably null Het
Slc22a22 T C 15: 57,244,946 Y491C probably damaging Het
Slc22a22 T A 15: 57,263,656 I6F probably damaging Het
Smpd1 C T 7: 105,555,582 L223F probably damaging Het
Spem1 T C 11: 69,820,915 K308E probably benign Het
Spsb1 A T 4: 149,906,450 C220* probably null Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tarsl2 T C 7: 65,689,971 S705P possibly damaging Het
Tbc1d16 G T 11: 119,153,955 F553L probably damaging Het
Thbs2 A G 17: 14,690,173 Y55H probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Txnl1 T C 18: 63,676,979 N131S probably benign Het
Vat1 T C 11: 101,463,020 T175A possibly damaging Het
Veph1 T A 3: 66,121,645 D651V probably benign Het
Zcchc6 G A 13: 59,815,698 T282I probably damaging Het
Zfp281 T A 1: 136,626,762 S493T probably benign Het
Other mutations in Ccdc190
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Ccdc190 APN 1 169933740 missense probably benign 0.12
IGL01696:Ccdc190 APN 1 169933824 missense probably damaging 0.98
IGL02108:Ccdc190 APN 1 169933986 missense probably damaging 0.99
IGL03239:Ccdc190 APN 1 169933980 missense probably benign 0.00
IGL03338:Ccdc190 APN 1 169929975 start codon destroyed probably null 0.53
R1341:Ccdc190 UTSW 1 169930017 missense probably damaging 0.99
R4828:Ccdc190 UTSW 1 169933896 missense probably damaging 0.99
R4892:Ccdc190 UTSW 1 169930109 missense possibly damaging 0.95
R5023:Ccdc190 UTSW 1 169933087 missense probably damaging 0.97
R5158:Ccdc190 UTSW 1 169933009 missense probably benign
R6505:Ccdc190 UTSW 1 169933023 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGCACCTTCTATCTCACGGTG -3'
(R):5'- AGTAATCTCTCAGACTCGGGG -3'

Sequencing Primer
(F):5'- TGAGAGAACCAGCTGCTTC -3'
(R):5'- GACATAGTGAGCATTCTTGGCC -3'
Posted On 2022-06-15