Incidental Mutation 'R9461:Sgsm1'
ID 714859
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9461 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 113276032 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048112
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057209
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112324
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154248
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abhd18 A T 3: 40,904,884 probably null Het
Aox1 G A 1: 58,077,577 probably null Het
Arpp21 C A 9: 112,136,636 R422L probably damaging Het
Ccdc190 G A 1: 169,933,920 G197D probably benign Het
Cdc42bpa G T 1: 180,142,296 L1243F probably damaging Het
Ces2b T A 8: 104,837,379 F462I probably benign Het
Cfap45 A G 1: 172,535,327 E295G possibly damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col24a1 G T 3: 145,481,124 E1227* probably null Het
Col5a1 A T 2: 28,032,604 D1717V unknown Het
Dab2 T C 15: 6,430,954 S448P possibly damaging Het
Dnajb1 T C 8: 83,608,544 probably null Het
Dock9 C T 14: 121,605,189 G1223D probably benign Het
Elp2 A G 18: 24,632,812 R670G probably damaging Het
Eppk1 T C 15: 76,110,468 I738V probably benign Het
Gas2l2 T A 11: 83,422,205 R760S probably damaging Het
Gm7534 G A 4: 134,202,001 P331L probably benign Het
H1fnt C T 15: 98,257,257 A4T probably damaging Het
Kif17 G A 4: 138,277,942 V273I probably damaging Het
Klhdc4 T C 8: 121,799,485 D336G probably damaging Het
Lmod2 A G 6: 24,603,569 N181S probably benign Het
Lrp8 G A 4: 107,843,318 G151D possibly damaging Het
Mb21d2 C T 16: 28,828,509 V238M probably damaging Het
Mfsd4b3 T G 10: 39,947,251 I338L probably benign Het
Nkain2 C T 10: 32,890,129 A112T unknown Het
Olfr1445 T A 19: 12,884,511 V210E possibly damaging Het
Olfr152 A G 2: 87,782,539 I2V probably benign Het
Olfr295 T A 7: 86,586,039 Y255N possibly damaging Het
Olfr667 T A 7: 104,916,376 I307F probably benign Het
Pacs2 A G 12: 113,047,107 I126V probably benign Het
Phyhipl T C 10: 70,559,413 Y321C possibly damaging Het
Ppm1k T C 6: 57,510,735 S368G probably damaging Het
Ranbp6 T C 19: 29,809,763 D1063G possibly damaging Het
Sars2 T C 7: 28,750,013 M322T probably benign Het
Serbp1 G A 6: 67,267,329 R78H probably benign Het
Sfxn2 T A 19: 46,585,753 N127K probably damaging Het
Slc22a22 T C 15: 57,244,946 Y491C probably damaging Het
Slc22a22 T A 15: 57,263,656 I6F probably damaging Het
Smpd1 C T 7: 105,555,582 L223F probably damaging Het
Spem1 T C 11: 69,820,915 K308E probably benign Het
Spsb1 A T 4: 149,906,450 C220* probably null Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tarsl2 T C 7: 65,689,971 S705P possibly damaging Het
Tbc1d16 G T 11: 119,153,955 F553L probably damaging Het
Thbs2 A G 17: 14,690,173 Y55H probably damaging Het
Tmem220 T C 11: 67,034,153 I138T possibly damaging Het
Txnl1 T C 18: 63,676,979 N131S probably benign Het
Vat1 T C 11: 101,463,020 T175A possibly damaging Het
Veph1 T A 3: 66,121,645 D651V probably benign Het
Zcchc6 G A 13: 59,815,698 T282I probably damaging Het
Zfp281 T A 1: 136,626,762 S493T probably benign Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGTTACTGCAGCAGAAC -3'
(R):5'- ACCAAGGTTATCGCTGAGCC -3'

Sequencing Primer
(F):5'- TGCAGCAGAACGTTATCCTG -3'
(R):5'- GTTATCGCTGAGCCCCCTTTC -3'
Posted On 2022-06-15