Incidental Mutation 'R9461:Dock9'
ID 714884
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9461 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121842601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1223 (G1223D)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: G1223D

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: G1223D

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: G1225D

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: G1225D

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: G1223D

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: G1237D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000212416
AA Change: G19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,228,176 (GRCm39) T22A possibly damaging Het
Abhd18 A T 3: 40,859,319 (GRCm39) probably null Het
Aox1 G A 1: 58,116,736 (GRCm39) probably null Het
Arpp21 C A 9: 111,965,704 (GRCm39) R422L probably damaging Het
Ccdc190 G A 1: 169,761,489 (GRCm39) G197D probably benign Het
Cdc42bpa G T 1: 179,969,861 (GRCm39) L1243F probably damaging Het
Ces2b T A 8: 105,564,011 (GRCm39) F462I probably benign Het
Cfap45 A G 1: 172,362,894 (GRCm39) E295G possibly damaging Het
Chst13 G A 6: 90,286,506 (GRCm39) P152L probably damaging Het
Col24a1 G T 3: 145,186,879 (GRCm39) E1227* probably null Het
Col5a1 A T 2: 27,922,616 (GRCm39) D1717V unknown Het
Dab2 T C 15: 6,460,435 (GRCm39) S448P possibly damaging Het
Dnajb1 T C 8: 84,335,173 (GRCm39) probably null Het
Elp2 A G 18: 24,765,869 (GRCm39) R670G probably damaging Het
Eppk1 T C 15: 75,994,668 (GRCm39) I738V probably benign Het
Gas2l2 T A 11: 83,313,031 (GRCm39) R760S probably damaging Het
H1f7 C T 15: 98,155,138 (GRCm39) A4T probably damaging Het
Kif17 G A 4: 138,005,253 (GRCm39) V273I probably damaging Het
Klhdc4 T C 8: 122,526,224 (GRCm39) D336G probably damaging Het
Lmod2 A G 6: 24,603,568 (GRCm39) N181S probably benign Het
Lrp8 G A 4: 107,700,515 (GRCm39) G151D possibly damaging Het
Mb21d2 C T 16: 28,647,261 (GRCm39) V238M probably damaging Het
Mfsd4b3-ps T G 10: 39,823,247 (GRCm39) I338L probably benign Het
Nkain2 C T 10: 32,766,125 (GRCm39) A112T unknown Het
Or14c41 T A 7: 86,235,247 (GRCm39) Y255N possibly damaging Het
Or52n2b T A 7: 104,565,583 (GRCm39) I307F probably benign Het
Or5b12b T A 19: 12,861,875 (GRCm39) V210E possibly damaging Het
Or5i1 A G 2: 87,612,883 (GRCm39) I2V probably benign Het
Pacs2 A G 12: 113,010,727 (GRCm39) I126V probably benign Het
Phyhipl T C 10: 70,395,243 (GRCm39) Y321C possibly damaging Het
Ppm1k T C 6: 57,487,720 (GRCm39) S368G probably damaging Het
Ranbp6 T C 19: 29,787,163 (GRCm39) D1063G possibly damaging Het
Sars2 T C 7: 28,449,438 (GRCm39) M322T probably benign Het
Serbp1 G A 6: 67,244,313 (GRCm39) R78H probably benign Het
Sfxn2 T A 19: 46,574,192 (GRCm39) N127K probably damaging Het
Sgsm1 A T 5: 113,423,898 (GRCm39) probably null Het
Slc22a22 T C 15: 57,108,342 (GRCm39) Y491C probably damaging Het
Slc22a22 T A 15: 57,127,052 (GRCm39) I6F probably damaging Het
Smpd1 C T 7: 105,204,789 (GRCm39) L223F probably damaging Het
Spem1 T C 11: 69,711,741 (GRCm39) K308E probably benign Het
Spsb1 A T 4: 149,990,907 (GRCm39) C220* probably null Het
Syngap1 T A 17: 27,173,962 (GRCm39) S190R possibly damaging Het
Tars3 T C 7: 65,339,719 (GRCm39) S705P possibly damaging Het
Tbc1d16 G T 11: 119,044,781 (GRCm39) F553L probably damaging Het
Thbs2 A G 17: 14,910,435 (GRCm39) Y55H probably damaging Het
Tmem220 T C 11: 66,924,979 (GRCm39) I138T possibly damaging Het
Tut7 G A 13: 59,963,512 (GRCm39) T282I probably damaging Het
Txnl1 T C 18: 63,810,050 (GRCm39) N131S probably benign Het
Vat1 T C 11: 101,353,846 (GRCm39) T175A possibly damaging Het
Veph1 T A 3: 66,029,066 (GRCm39) D651V probably benign Het
Zfp281 T A 1: 136,554,500 (GRCm39) S493T probably benign Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCTGATTACAATGCCTGAAC -3'
(R):5'- CTCCAGATGCTGAACACGTC -3'

Sequencing Primer
(F):5'- ACAATGCCTGAACTGTTTCAC -3'
(R):5'- CCAGATGCTGAACACGTCTAGTTG -3'
Posted On 2022-06-15