Incidental Mutation 'R9463:BC055324'
ID 714980
Institutional Source Beutler Lab
Gene Symbol BC055324
Ensembl Gene ENSMUSG00000041406
Gene Name cDNA sequence BC055324
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9463 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 163945993-163994796 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 163968338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 428 (M428K)
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045876] [ENSMUST00000097493]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045876
AA Change: M428K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406
AA Change: M428K

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
AA Change: M428K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406
AA Change: M428K

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,256,789 E25K probably damaging Het
Acss2 A G 2: 155,550,112 Y218C probably benign Het
Armc8 C T 9: 99,496,150 probably null Het
Aspg G A 12: 112,123,390 G454D probably damaging Het
Atp9b T C 18: 80,765,836 T623A Het
Cacna1e A G 1: 154,481,665 L655P probably damaging Het
Cant1 T A 11: 118,411,455 N12I probably damaging Het
Cep63 T C 9: 102,598,183 T445A probably benign Het
Clstn1 A T 4: 149,614,107 D50V possibly damaging Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Col4a4 T C 1: 82,453,355 M1609V unknown Het
Dand5 A T 8: 84,816,309 C179* probably null Het
Dbndd1 A G 8: 123,506,808 L153P probably damaging Het
Dnhd1 A G 7: 105,657,247 I437V probably benign Het
Dnhd1 T A 7: 105,695,016 S1856T probably benign Het
Dpp8 T A 9: 65,066,418 Y641* probably null Het
Dthd1 G A 5: 62,882,283 R676H probably benign Het
Efl1 C T 7: 82,777,525 T1077M probably damaging Het
Eif3e G T 15: 43,275,313 Q83K probably benign Het
Gfm2 G A 13: 97,150,402 A170T probably damaging Het
Gm14496 T A 2: 182,000,463 H642Q probably benign Het
Gmip G A 8: 69,817,043 R596Q possibly damaging Het
Hook1 A T 4: 96,022,273 Q708L probably damaging Het
Krtap9-3 G A 11: 99,597,700 R119C unknown Het
Lnpk A C 2: 74,551,059 probably null Het
Lrp1 G T 10: 127,593,465 Y484* probably null Het
Lrrc8e C T 8: 4,235,185 P470L probably damaging Het
Mapre1 A G 2: 153,765,040 N231D probably benign Het
Muc5b T A 7: 141,851,766 N937K unknown Het
Ndufaf7 T C 17: 78,946,471 probably null Het
Nlrp5 A T 7: 23,418,800 I650F probably benign Het
Notch1 T C 2: 26,469,833 D1290G probably benign Het
Olfr845 C T 9: 19,339,024 A188V possibly damaging Het
Olfr910 T C 9: 38,539,369 I158T probably damaging Het
Orc4 C T 2: 48,936,771 probably null Het
Plekhm2 A G 4: 141,630,638 V664A probably benign Het
Pom121l2 T G 13: 21,984,232 I891S probably benign Het
Prkcsh T C 9: 22,012,686 Y425H probably damaging Het
Prps1l1 A C 12: 34,985,560 T225P probably damaging Het
Prr18 T G 17: 8,341,492 V160G probably damaging Het
Psd2 T A 18: 36,010,745 F701L probably damaging Het
Sclt1 T C 3: 41,647,496 E593G probably damaging Het
Sdk1 T C 5: 141,962,793 I631T probably benign Het
Sirt1 A T 10: 63,335,708 D231E probably benign Het
Slc22a30 C T 19: 8,400,895 C139Y probably damaging Het
Sntg1 T A 1: 8,554,750 N274I probably damaging Het
Spocd1 A G 4: 129,953,605 Q529R Het
Trbv3 T A 6: 41,048,596 L40H probably damaging Het
Trpm6 T C 19: 18,783,900 probably null Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Tusc5 T A 11: 76,680,272 L38Q probably damaging Het
Ush1g C A 11: 115,318,230 L379F probably damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn2r73 A T 7: 85,857,587 M839K Het
Wee1 T C 7: 110,122,710 S121P probably damaging Het
Zfp608 T C 18: 54,897,202 K1222R probably damaging Het
Other mutations in BC055324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:BC055324 APN 1 163957522 missense probably benign 0.01
IGL02638:BC055324 APN 1 163959299 nonsense probably null
IGL03337:BC055324 APN 1 163990759 missense probably damaging 0.96
IGL03048:BC055324 UTSW 1 163964525 missense probably benign 0.04
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0414:BC055324 UTSW 1 163968321 missense probably benign 0.02
R0511:BC055324 UTSW 1 163971843 splice site probably null
R1323:BC055324 UTSW 1 163955461 unclassified probably benign
R1870:BC055324 UTSW 1 163964794 missense probably damaging 1.00
R2129:BC055324 UTSW 1 163966457 missense probably damaging 1.00
R3716:BC055324 UTSW 1 163956888 missense probably damaging 1.00
R3783:BC055324 UTSW 1 163987683 missense probably benign 0.27
R3872:BC055324 UTSW 1 163986964 missense probably damaging 0.99
R4427:BC055324 UTSW 1 163954284 missense probably benign
R5069:BC055324 UTSW 1 163987674 missense possibly damaging 0.59
R5620:BC055324 UTSW 1 163962044 nonsense probably null
R5681:BC055324 UTSW 1 163962085 missense probably damaging 1.00
R5699:BC055324 UTSW 1 163957551 missense probably benign 0.26
R5936:BC055324 UTSW 1 163987012 missense probably benign 0.00
R6065:BC055324 UTSW 1 163959388 missense probably benign 0.08
R6065:BC055324 UTSW 1 163987688 missense probably damaging 1.00
R6075:BC055324 UTSW 1 163978087 missense probably damaging 1.00
R6466:BC055324 UTSW 1 163954165 missense probably benign 0.01
R6701:BC055324 UTSW 1 163971843 splice site probably null
R6776:BC055324 UTSW 1 163976749 missense probably damaging 1.00
R6851:BC055324 UTSW 1 163964767 missense probably damaging 1.00
R6923:BC055324 UTSW 1 163986885 critical splice donor site probably null
R7125:BC055324 UTSW 1 163962062 missense probably benign 0.00
R7361:BC055324 UTSW 1 163986033 missense possibly damaging 0.54
R7492:BC055324 UTSW 1 163959328 missense probably benign 0.35
R8528:BC055324 UTSW 1 163986083 missense probably damaging 1.00
R8755:BC055324 UTSW 1 163959326 missense probably damaging 1.00
R8786:BC055324 UTSW 1 163964471 missense probably damaging 1.00
R8938:BC055324 UTSW 1 163961972 missense probably benign 0.01
R8957:BC055324 UTSW 1 163964766 missense probably damaging 1.00
R9023:BC055324 UTSW 1 163990731 missense possibly damaging 0.83
R9132:BC055324 UTSW 1 163986945 missense probably damaging 0.99
R9159:BC055324 UTSW 1 163986945 missense probably damaging 0.99
R9229:BC055324 UTSW 1 163967090 missense probably damaging 1.00
R9310:BC055324 UTSW 1 163964520 missense probably damaging 1.00
R9455:BC055324 UTSW 1 163954152 missense probably benign 0.05
R9597:BC055324 UTSW 1 163976771 missense probably null 1.00
R9646:BC055324 UTSW 1 163994626 missense probably damaging 0.97
Z1177:BC055324 UTSW 1 163964517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAGCCGAGGAAACAATGA -3'
(R):5'- GACGGCATGTCCATTTTGAAA -3'

Sequencing Primer
(F):5'- CCAGCCGAGGAAACAATGAAGAATG -3'
(R):5'- GACACTGTGATTCTCTAAAGTA -3'
Posted On 2022-06-15