Incidental Mutation 'R9463:Efl1'
ID 714997
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R9463 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82426733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1077 (T1077M)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T1077M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T1077M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T1077M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T1077M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,256,789 (GRCm38) E25K probably damaging Het
Acss2 A G 2: 155,392,032 (GRCm39) Y218C probably benign Het
Armc8 C T 9: 99,378,203 (GRCm39) probably null Het
Aspg G A 12: 112,089,824 (GRCm39) G454D probably damaging Het
Atp9b T C 18: 80,809,051 (GRCm39) T623A Het
Cacna1e A G 1: 154,357,411 (GRCm39) L655P probably damaging Het
Cant1 T A 11: 118,302,281 (GRCm39) N12I probably damaging Het
Cep63 T C 9: 102,475,382 (GRCm39) T445A probably benign Het
Clstn1 A T 4: 149,698,564 (GRCm39) D50V possibly damaging Het
Cnnm2 T A 19: 46,750,990 (GRCm39) I260N probably damaging Het
Col4a4 T C 1: 82,431,076 (GRCm39) M1609V unknown Het
Dand5 A T 8: 85,542,938 (GRCm39) C179* probably null Het
Dbndd1 A G 8: 124,233,547 (GRCm39) L153P probably damaging Het
Dnhd1 A G 7: 105,306,454 (GRCm39) I437V probably benign Het
Dnhd1 T A 7: 105,344,223 (GRCm39) S1856T probably benign Het
Dpp8 T A 9: 64,973,700 (GRCm39) Y641* probably null Het
Dthd1 G A 5: 63,039,626 (GRCm39) R676H probably benign Het
Eif3e G T 15: 43,138,709 (GRCm39) Q83K probably benign Het
Firrm A T 1: 163,795,907 (GRCm39) M428K probably benign Het
Gfm2 G A 13: 97,286,910 (GRCm39) A170T probably damaging Het
Gm14496 T A 2: 181,642,256 (GRCm39) H642Q probably benign Het
Gmip G A 8: 70,269,693 (GRCm39) R596Q possibly damaging Het
Hook1 A T 4: 95,910,510 (GRCm39) Q708L probably damaging Het
Krtap9-3 G A 11: 99,488,526 (GRCm39) R119C unknown Het
Lnpk A C 2: 74,381,403 (GRCm39) probably null Het
Lrp1 G T 10: 127,429,334 (GRCm39) Y484* probably null Het
Lrrc8e C T 8: 4,285,185 (GRCm39) P470L probably damaging Het
Mapre1 A G 2: 153,606,960 (GRCm39) N231D probably benign Het
Muc5b T A 7: 141,405,503 (GRCm39) N937K unknown Het
Ndufaf7 T C 17: 79,253,900 (GRCm39) probably null Het
Nlrp5 A T 7: 23,118,225 (GRCm39) I650F probably benign Het
Notch1 T C 2: 26,359,845 (GRCm39) D1290G probably benign Het
Or7g27 C T 9: 19,250,320 (GRCm39) A188V possibly damaging Het
Or8b46 T C 9: 38,450,665 (GRCm39) I158T probably damaging Het
Orc4 C T 2: 48,826,783 (GRCm39) probably null Het
Plekhm2 A G 4: 141,357,949 (GRCm39) V664A probably benign Het
Pom121l2 T G 13: 22,168,402 (GRCm39) I891S probably benign Het
Prkcsh T C 9: 21,923,982 (GRCm39) Y425H probably damaging Het
Prps1l1 A C 12: 35,035,559 (GRCm39) T225P probably damaging Het
Prr18 T G 17: 8,560,324 (GRCm39) V160G probably damaging Het
Psd2 T A 18: 36,143,798 (GRCm39) F701L probably damaging Het
Sclt1 T C 3: 41,601,931 (GRCm39) E593G probably damaging Het
Sdk1 T C 5: 141,948,548 (GRCm39) I631T probably benign Het
Sirt1 A T 10: 63,171,487 (GRCm39) D231E probably benign Het
Slc22a30 C T 19: 8,378,259 (GRCm39) C139Y probably damaging Het
Sntg1 T A 1: 8,624,974 (GRCm39) N274I probably damaging Het
Spocd1 A G 4: 129,847,398 (GRCm39) Q529R Het
Trarg1 T A 11: 76,571,098 (GRCm39) L38Q probably damaging Het
Trbv3 T A 6: 41,025,530 (GRCm39) L40H probably damaging Het
Trpm6 T C 19: 18,761,264 (GRCm39) probably null Het
Ttn A G 2: 76,578,519 (GRCm39) Y24125H probably damaging Het
Ush1g C A 11: 115,209,056 (GRCm39) L379F probably damaging Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn2r73 A T 7: 85,506,795 (GRCm39) M839K Het
Wee1 T C 7: 109,721,917 (GRCm39) S121P probably damaging Het
Zfp608 T C 18: 55,030,274 (GRCm39) K1222R probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAACTCAGAATGACAGATGTTC -3'
(R):5'- CCACCAGCAGTAGTGACTTC -3'

Sequencing Primer
(F):5'- CTCAGAATGACAGATGTTCCAAATC -3'
(R):5'- CACCAGCAGTAGTGACTTCTTTTTAG -3'
Posted On 2022-06-15