Incidental Mutation 'R9463:Efl1'
ID 714997
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GPTase 1
Synonyms 6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock # R9463 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 82648614-82777852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82777525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1077 (T1077M)
Ref Sequence ENSEMBL: ENSMUSP00000046046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T1077M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T1077M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T1077M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T1077M

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 C T 14: 8,256,789 E25K probably damaging Het
Acss2 A G 2: 155,550,112 Y218C probably benign Het
Armc8 C T 9: 99,496,150 probably null Het
Aspg G A 12: 112,123,390 G454D probably damaging Het
Atp9b T C 18: 80,765,836 T623A Het
BC055324 A T 1: 163,968,338 M428K probably benign Het
Cacna1e A G 1: 154,481,665 L655P probably damaging Het
Cant1 T A 11: 118,411,455 N12I probably damaging Het
Cep63 T C 9: 102,598,183 T445A probably benign Het
Clstn1 A T 4: 149,614,107 D50V possibly damaging Het
Cnnm2 T A 19: 46,762,551 I260N probably damaging Het
Col4a4 T C 1: 82,453,355 M1609V unknown Het
Dand5 A T 8: 84,816,309 C179* probably null Het
Dbndd1 A G 8: 123,506,808 L153P probably damaging Het
Dnhd1 A G 7: 105,657,247 I437V probably benign Het
Dnhd1 T A 7: 105,695,016 S1856T probably benign Het
Dpp8 T A 9: 65,066,418 Y641* probably null Het
Dthd1 G A 5: 62,882,283 R676H probably benign Het
Eif3e G T 15: 43,275,313 Q83K probably benign Het
Gfm2 G A 13: 97,150,402 A170T probably damaging Het
Gm14496 T A 2: 182,000,463 H642Q probably benign Het
Gmip G A 8: 69,817,043 R596Q possibly damaging Het
Hook1 A T 4: 96,022,273 Q708L probably damaging Het
Krtap9-3 G A 11: 99,597,700 R119C unknown Het
Lnpk A C 2: 74,551,059 probably null Het
Lrp1 G T 10: 127,593,465 Y484* probably null Het
Lrrc8e C T 8: 4,235,185 P470L probably damaging Het
Mapre1 A G 2: 153,765,040 N231D probably benign Het
Muc5b T A 7: 141,851,766 N937K unknown Het
Ndufaf7 T C 17: 78,946,471 probably null Het
Nlrp5 A T 7: 23,418,800 I650F probably benign Het
Notch1 T C 2: 26,469,833 D1290G probably benign Het
Olfr845 C T 9: 19,339,024 A188V possibly damaging Het
Olfr910 T C 9: 38,539,369 I158T probably damaging Het
Orc4 C T 2: 48,936,771 probably null Het
Plekhm2 A G 4: 141,630,638 V664A probably benign Het
Pom121l2 T G 13: 21,984,232 I891S probably benign Het
Prkcsh T C 9: 22,012,686 Y425H probably damaging Het
Prps1l1 A C 12: 34,985,560 T225P probably damaging Het
Prr18 T G 17: 8,341,492 V160G probably damaging Het
Psd2 T A 18: 36,010,745 F701L probably damaging Het
Sclt1 T C 3: 41,647,496 E593G probably damaging Het
Sdk1 T C 5: 141,962,793 I631T probably benign Het
Sirt1 A T 10: 63,335,708 D231E probably benign Het
Slc22a30 C T 19: 8,400,895 C139Y probably damaging Het
Sntg1 T A 1: 8,554,750 N274I probably damaging Het
Spocd1 A G 4: 129,953,605 Q529R Het
Trbv3 T A 6: 41,048,596 L40H probably damaging Het
Trpm6 T C 19: 18,783,900 probably null Het
Ttn A G 2: 76,748,175 Y24125H probably damaging Het
Tusc5 T A 11: 76,680,272 L38Q probably damaging Het
Ush1g C A 11: 115,318,230 L379F probably damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn2r73 A T 7: 85,857,587 M839K Het
Wee1 T C 7: 110,122,710 S121P probably damaging Het
Zfp608 T C 18: 54,897,202 K1222R probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
R9762:Efl1 UTSW 7 82763388 missense probably benign 0.09
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGAACTCAGAATGACAGATGTTC -3'
(R):5'- CCACCAGCAGTAGTGACTTC -3'

Sequencing Primer
(F):5'- CTCAGAATGACAGATGTTCCAAATC -3'
(R):5'- CACCAGCAGTAGTGACTTCTTTTTAG -3'
Posted On 2022-06-15