Incidental Mutation 'R9464:Mug2'
ID 715056
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9464 (G1)
Quality Score 185.009
Status Not validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 122051731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 561 (D561E)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: D561E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: D561E

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik T C 1: 160,075,295 F45S possibly damaging Het
Abca4 A G 3: 122,120,065 T897A probably benign Het
Abhd5 A T 9: 122,378,964 T308S probably benign Het
Abi2 G A 1: 60,438,941 probably null Het
Abi3bp C A 16: 56,588,683 T283N possibly damaging Het
Adcy2 A C 13: 68,734,657 N320K probably damaging Het
Adcy3 T A 12: 4,206,939 M819K probably benign Het
Anapc5 A G 5: 122,802,146 V354A probably benign Het
Card14 A G 11: 119,317,205 I34V probably benign Het
Ccdc153 A T 9: 44,245,714 T118S possibly damaging Het
Champ1 G A 8: 13,879,114 G424D probably damaging Het
Crybg3 A T 16: 59,555,757 probably benign Het
Ctsr T A 13: 61,159,481 I334F possibly damaging Het
Dlgap1 A T 17: 70,516,969 Q316H probably benign Het
Dnajc18 A C 18: 35,697,113 C80G probably damaging Het
Dthd1 G A 5: 62,882,283 R676H probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fancc T C 13: 63,402,955 K18E possibly damaging Het
Fbxo46 G C 7: 19,136,866 R470P probably damaging Het
Fbxw20 A C 9: 109,221,331 W409G probably damaging Het
Gcnt4 C T 13: 96,946,985 T263M probably benign Het
Gfy T C 7: 45,177,827 T282A probably benign Het
Glb1l3 A G 9: 26,850,055 M227T probably damaging Het
Gm10334 A G 6: 41,443,552 V80A probably benign Het
Gm8267 T C 14: 44,722,889 E133G probably damaging Het
Hmcn1 A C 1: 150,723,497 I1556R possibly damaging Het
Hrasls5 A G 19: 7,614,558 E113G probably damaging Het
Ifnl3 T C 7: 28,523,862 V102A probably damaging Het
Kifc3 C T 8: 95,103,994 R548Q possibly damaging Het
Lonrf1 T A 8: 36,222,870 Q678L probably benign Het
Map2 A G 1: 66,415,338 E1129G probably damaging Het
Myo3a G T 2: 22,227,572 probably benign Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nckap5 C T 1: 126,024,757 G1353R probably benign Het
Nek10 T A 14: 14,937,766 H828Q probably benign Het
Olfr172 G T 16: 58,760,839 C112* probably null Het
Olfr665 T A 7: 104,880,843 C45* probably null Het
Pclo T C 5: 14,766,816 S1297P Het
Pkhd1l1 T C 15: 44,479,613 I162T probably damaging Het
Plekhg2 T C 7: 28,362,872 E541G probably damaging Het
Ppp1r15a T C 7: 45,524,725 N220D possibly damaging Het
Psmd4 A G 3: 95,033,424 S343P probably benign Het
Rnf213 A T 11: 119,463,580 H4063L Het
Rnf40 T C 7: 127,591,782 V313A probably benign Het
Ryr2 T A 13: 11,737,794 E1880D probably benign Het
Slc30a4 A T 2: 122,685,280 L398I probably damaging Het
Sp100 A T 1: 85,697,030 N380I probably damaging Het
Speer4d T G 5: 15,623,395 L175W probably damaging Het
Srcap T A 7: 127,538,101 I985K possibly damaging Het
Tesk2 T C 4: 116,801,246 probably null Het
Tgfbrap1 A G 1: 43,075,448 V164A probably damaging Het
Tlk1 T C 2: 70,713,997 T765A probably benign Het
Tmem207 A T 16: 26,526,663 C18S Het
Tph2 A T 10: 115,080,087 C394S probably benign Het
Trrap C A 5: 144,826,707 H2470N probably damaging Het
Ttc21b T C 2: 66,223,522 Y771C probably damaging Het
Uchl3 T C 14: 101,667,015 F122L probably damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn2r117 G T 17: 23,477,604 D276E probably benign Het
Vps13c T C 9: 67,951,392 L2708P probably damaging Het
Vwa3a T A 7: 120,786,459 S675T possibly damaging Het
Zfp473 A G 7: 44,734,342 L189P probably benign Het
Zfp956 T A 6: 47,964,107 C467S probably damaging Het
Zgrf1 T A 3: 127,584,092 N995K probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTAAATCAATCCCAGGGG -3'
(R):5'- TGTTTCATCAGAGCCAGGGTC -3'

Sequencing Primer
(F):5'- TCCCAGGGGAGAAAGGGG -3'
(R):5'- AGCCAGGGTCACTTCTGGTATC -3'
Posted On 2022-06-15