Mutagenetix > Incidental Mutation

Incidental Mutation 'R9464:Rnf213'

715079

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9464 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119283926-119378244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119354406 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 4063 (H4063L)

Ref Sequence

ENSEMBL: ENSMUSP00000091429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: H4063L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: H4062L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: H4062L

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	T	C	1: 159,902,865 (GRCm39)	F45S	possibly damaging	Het
Abca4	A	G	3: 121,913,714 (GRCm39)	T897A	probably benign	Het
Abhd5	A	T	9: 122,208,029 (GRCm39)	T308S	probably benign	Het
Abi2	G	A	1: 60,478,100 (GRCm39)		probably null	Het
Abi3bp	C	A	16: 56,409,046 (GRCm39)	T283N	possibly damaging	Het
Adcy2	A	C	13: 68,882,776 (GRCm39)	N320K	probably damaging	Het
Adcy3	T	A	12: 4,256,939 (GRCm39)	M819K	probably benign	Het
Anapc5	A	G	5: 122,940,209 (GRCm39)	V354A	probably benign	Het
Card14	A	G	11: 119,208,031 (GRCm39)	I34V	probably benign	Het
Ccdc153	A	T	9: 44,157,011 (GRCm39)	T118S	possibly damaging	Het
Champ1	G	A	8: 13,929,114 (GRCm39)	G424D	probably damaging	Het
Crybg3	A	T	16: 59,376,120 (GRCm39)		probably benign	Het
Ctsr	T	A	13: 61,307,295 (GRCm39)	I334F	possibly damaging	Het
Dlgap1	A	T	17: 70,823,964 (GRCm39)	Q316H	probably benign	Het
Dnajc18	A	C	18: 35,830,166 (GRCm39)	C80G	probably damaging	Het
Dthd1	G	A	5: 63,039,626 (GRCm39)	R676H	probably benign	Het
Fam186b	G	A	15: 99,177,616 (GRCm39)	A570V	probably damaging	Het
Fancc	T	C	13: 63,550,769 (GRCm39)	K18E	possibly damaging	Het
Fbxo46	G	C	7: 18,870,791 (GRCm39)	R470P	probably damaging	Het
Fbxw20	A	C	9: 109,050,399 (GRCm39)	W409G	probably damaging	Het
Gcnt4	C	T	13: 97,083,493 (GRCm39)	T263M	probably benign	Het
Gfy	T	C	7: 44,827,251 (GRCm39)	T282A	probably benign	Het
Glb1l3	A	G	9: 26,761,351 (GRCm39)	M227T	probably damaging	Het
Gm8267	T	C	14: 44,960,346 (GRCm39)	E133G	probably damaging	Het
Hmcn1	A	C	1: 150,599,248 (GRCm39)	I1556R	possibly damaging	Het
Ifnl3	T	C	7: 28,223,287 (GRCm39)	V102A	probably damaging	Het
Kifc3	C	T	8: 95,830,622 (GRCm39)	R548Q	possibly damaging	Het
Lonrf1	T	A	8: 36,690,024 (GRCm39)	Q678L	probably benign	Het
Map2	A	G	1: 66,454,497 (GRCm39)	E1129G	probably damaging	Het
Mug2	C	A	6: 122,028,690 (GRCm39)	D561E	probably benign	Het
Myo3a	G	T	2: 22,232,383 (GRCm39)		probably benign	Het
N4bp1	A	G	8: 87,587,165 (GRCm39)	V591A	probably damaging	Het
Nckap5	C	T	1: 125,952,494 (GRCm39)	G1353R	probably benign	Het
Nek10	T	A	14: 14,937,766 (GRCm38)	H828Q	probably benign	Het
Or52n3	T	A	7: 104,530,050 (GRCm39)	C45*	probably null	Het
Or5k1b	G	T	16: 58,581,202 (GRCm39)	C112*	probably null	Het
Pclo	T	C	5: 14,816,830 (GRCm39)	S1297P		Het
Pkhd1l1	T	C	15: 44,343,009 (GRCm39)	I162T	probably damaging	Het
Plaat5	A	G	19: 7,591,923 (GRCm39)	E113G	probably damaging	Het
Plekhg2	T	C	7: 28,062,297 (GRCm39)	E541G	probably damaging	Het
Ppp1r15a	T	C	7: 45,174,149 (GRCm39)	N220D	possibly damaging	Het
Prss3l	A	G	6: 41,420,486 (GRCm39)	V80A	probably benign	Het
Psmd4	A	G	3: 94,940,735 (GRCm39)	S343P	probably benign	Het
Rnf40	T	C	7: 127,190,954 (GRCm39)	V313A	probably benign	Het
Ryr2	T	A	13: 11,752,680 (GRCm39)	E1880D	probably benign	Het
Slc30a4	A	T	2: 122,527,200 (GRCm39)	L398I	probably damaging	Het
Sp100	A	T	1: 85,624,751 (GRCm39)	N380I	probably damaging	Het
Speer4d	T	G	5: 15,828,393 (GRCm39)	L175W	probably damaging	Het
Srcap	T	A	7: 127,137,273 (GRCm39)	I985K	possibly damaging	Het
Tesk2	T	C	4: 116,658,443 (GRCm39)		probably null	Het
Tgfbrap1	A	G	1: 43,114,608 (GRCm39)	V164A	probably damaging	Het
Tlk1	T	C	2: 70,544,341 (GRCm39)	T765A	probably benign	Het
Tmem207	A	T	16: 26,345,413 (GRCm39)	C18S		Het
Tph2	A	T	10: 114,915,992 (GRCm39)	C394S	probably benign	Het
Trrap	C	A	5: 144,763,517 (GRCm39)	H2470N	probably damaging	Het
Ttc21b	T	C	2: 66,053,866 (GRCm39)	Y771C	probably damaging	Het
Uchl3	T	C	14: 101,904,451 (GRCm39)	F122L	probably damaging	Het
Vipr1	G	A	9: 121,471,993 (GRCm39)		probably null	Het
Vmn2r117	G	T	17: 23,696,578 (GRCm39)	D276E	probably benign	Het
Vps13c	T	C	9: 67,858,674 (GRCm39)	L2708P	probably damaging	Het
Vwa3a	T	A	7: 120,385,682 (GRCm39)	S675T	possibly damaging	Het
Zfp473	A	G	7: 44,383,766 (GRCm39)	L189P	probably benign	Het
Zfp956	T	A	6: 47,941,041 (GRCm39)	C467S	probably damaging	Het
Zgrf1	T	A	3: 127,377,741 (GRCm39)	N995K	probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,340,169 (GRCm39)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,331,669 (GRCm39)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,338,063 (GRCm39)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,373,944 (GRCm39)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,334,126 (GRCm39)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,340,702 (GRCm39)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,327,178 (GRCm39)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,332,133 (GRCm39)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,333,092 (GRCm39)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,333,841 (GRCm39)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,307,283 (GRCm39)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,334,094 (GRCm39)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,309,135 (GRCm39)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,336,499 (GRCm39)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,331,476 (GRCm39)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,371,733 (GRCm39)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,354,162 (GRCm39)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,327,628 (GRCm39)	missense	probably benign
IGL02588:Rnf213	APN	11	119,307,362 (GRCm39)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,331,615 (GRCm39)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,325,892 (GRCm39)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,318,336 (GRCm39)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,370,767 (GRCm39)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,336,452 (GRCm39)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,331,913 (GRCm39)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,355,833 (GRCm39)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,364,998 (GRCm39)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,333,830 (GRCm39)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,312,294 (GRCm39)	missense	probably benign	0.34
attrition	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
defame	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
Derogate	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
dinky	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,325,568 (GRCm39)	missense
Impugn	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,316,895 (GRCm39)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
PIT4585001:Rnf213	UTSW	11	119,349,218 (GRCm39)	missense
R0008:Rnf213	UTSW	11	119,355,878 (GRCm39)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,332,432 (GRCm39)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,293,401 (GRCm39)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,305,413 (GRCm39)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,307,322 (GRCm39)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,370,426 (GRCm39)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,305,347 (GRCm39)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,328,931 (GRCm39)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,316,937 (GRCm39)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,338,083 (GRCm39)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,316,838 (GRCm39)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,333,946 (GRCm39)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,355,908 (GRCm39)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,334,106 (GRCm39)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,322,543 (GRCm39)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,332,660 (GRCm39)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,331,976 (GRCm39)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,331,894 (GRCm39)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,364,306 (GRCm39)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,313,921 (GRCm39)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,321,312 (GRCm39)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,305,396 (GRCm39)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,307,389 (GRCm39)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,343,407 (GRCm39)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,376,824 (GRCm39)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,368,055 (GRCm39)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,326,809 (GRCm39)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,327,003 (GRCm39)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,326,831 (GRCm39)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,333,226 (GRCm39)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,328,576 (GRCm39)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,371,715 (GRCm39)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,332,714 (GRCm39)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,333,533 (GRCm39)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,332,665 (GRCm39)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,305,352 (GRCm39)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,327,437 (GRCm39)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,354,171 (GRCm39)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,333,405 (GRCm39)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,328,498 (GRCm39)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,331,047 (GRCm39)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,332,009 (GRCm39)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,340,955 (GRCm39)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,307,274 (GRCm39)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,322,511 (GRCm39)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,371,721 (GRCm39)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,331,933 (GRCm39)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,326,848 (GRCm39)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,352,744 (GRCm39)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,358,128 (GRCm39)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,333,489 (GRCm39)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,318,839 (GRCm39)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,341,027 (GRCm39)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,334,516 (GRCm39)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,306,019 (GRCm39)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,305,896 (GRCm39)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,350,835 (GRCm39)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,327,254 (GRCm39)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,305,430 (GRCm39)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,334,021 (GRCm39)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,350,764 (GRCm39)	splice site	probably null
R2698:Rnf213	UTSW	11	119,300,970 (GRCm39)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,359,718 (GRCm39)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,332,802 (GRCm39)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,370,384 (GRCm39)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R4014:Rnf213	UTSW	11	119,336,555 (GRCm39)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,373,274 (GRCm39)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,373,832 (GRCm39)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,300,308 (GRCm39)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,332,069 (GRCm39)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,374,790 (GRCm39)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,370,496 (GRCm39)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,328,521 (GRCm39)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,331,951 (GRCm39)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,331,175 (GRCm39)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,336,571 (GRCm39)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,307,455 (GRCm39)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,333,589 (GRCm39)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,372,066 (GRCm39)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,318,983 (GRCm39)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,327,590 (GRCm39)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,301,633 (GRCm39)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,349,692 (GRCm39)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,331,642 (GRCm39)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,331,634 (GRCm39)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,299,846 (GRCm39)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,305,902 (GRCm39)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,324,325 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,731 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,455 (GRCm39)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,349,611 (GRCm39)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,325,512 (GRCm39)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,374,720 (GRCm39)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,327,121 (GRCm39)	missense	probably benign
R5861:Rnf213	UTSW	11	119,364,203 (GRCm39)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,312,195 (GRCm39)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,333,905 (GRCm39)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,376,836 (GRCm39)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,332,927 (GRCm39)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,307,385 (GRCm39)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,302,339 (GRCm39)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,302,296 (GRCm39)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,332,854 (GRCm39)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,326,825 (GRCm39)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,349,254 (GRCm39)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,305,374 (GRCm39)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,354,192 (GRCm39)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,367,904 (GRCm39)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,350,792 (GRCm39)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,343,513 (GRCm39)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,327,106 (GRCm39)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,370,746 (GRCm39)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,333,097 (GRCm39)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,353,111 (GRCm39)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,339,664 (GRCm39)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,340,692 (GRCm39)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,370,481 (GRCm39)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,328,430 (GRCm39)	splice site	probably null
R7170:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7185:Rnf213	UTSW	11	119,315,024 (GRCm39)	missense
R7239:Rnf213	UTSW	11	119,349,614 (GRCm39)	missense
R7258:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7259:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7260:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7273:Rnf213	UTSW	11	119,322,582 (GRCm39)	splice site	probably null
R7282:Rnf213	UTSW	11	119,328,818 (GRCm39)	missense
R7311:Rnf213	UTSW	11	119,307,373 (GRCm39)	missense
R7352:Rnf213	UTSW	11	119,334,405 (GRCm39)	missense
R7369:Rnf213	UTSW	11	119,321,294 (GRCm39)	missense
R7410:Rnf213	UTSW	11	119,325,877 (GRCm39)	missense
R7448:Rnf213	UTSW	11	119,372,117 (GRCm39)	missense
R7561:Rnf213	UTSW	11	119,332,545 (GRCm39)	missense
R7573:Rnf213	UTSW	11	119,349,310 (GRCm39)	missense
R7615:Rnf213	UTSW	11	119,358,123 (GRCm39)	missense
R7680:Rnf213	UTSW	11	119,370,382 (GRCm39)	missense
R7739:Rnf213	UTSW	11	119,301,687 (GRCm39)	missense
R7789:Rnf213	UTSW	11	119,361,045 (GRCm39)	splice site	probably null
R7806:Rnf213	UTSW	11	119,302,371 (GRCm39)	missense
R8031:Rnf213	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,332,480 (GRCm39)	missense
R8053:Rnf213	UTSW	11	119,293,473 (GRCm39)	missense
R8284:Rnf213	UTSW	11	119,318,909 (GRCm39)	missense
R8301:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
R8325:Rnf213	UTSW	11	119,321,271 (GRCm39)	missense
R8332:Rnf213	UTSW	11	119,374,524 (GRCm39)	missense
R8443:Rnf213	UTSW	11	119,340,149 (GRCm39)	missense
R8518:Rnf213	UTSW	11	119,353,043 (GRCm39)	missense
R8531:Rnf213	UTSW	11	119,365,031 (GRCm39)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,349,563 (GRCm39)	missense
R8675:Rnf213	UTSW	11	119,346,984 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,332,038 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,308,955 (GRCm39)	missense
R8714:Rnf213	UTSW	11	119,359,720 (GRCm39)	missense
R8802:Rnf213	UTSW	11	119,352,928 (GRCm39)	missense
R8861:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense
R8886:Rnf213	UTSW	11	119,364,264 (GRCm39)	missense
R8893:Rnf213	UTSW	11	119,333,868 (GRCm39)	missense
R8937:Rnf213	UTSW	11	119,321,100 (GRCm39)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,305,250 (GRCm39)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,352,756 (GRCm39)	missense
R8983:Rnf213	UTSW	11	119,321,175 (GRCm39)	missense
R9043:Rnf213	UTSW	11	119,349,739 (GRCm39)	missense
R9081:Rnf213	UTSW	11	119,357,062 (GRCm39)	missense
R9132:Rnf213	UTSW	11	119,374,742 (GRCm39)	missense
R9135:Rnf213	UTSW	11	119,299,573 (GRCm39)	missense
R9146:Rnf213	UTSW	11	119,334,499 (GRCm39)	missense
R9156:Rnf213	UTSW	11	119,331,574 (GRCm39)	missense
R9183:Rnf213	UTSW	11	119,318,448 (GRCm39)	missense
R9234:Rnf213	UTSW	11	119,340,943 (GRCm39)	missense
R9275:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9278:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9296:Rnf213	UTSW	11	119,334,621 (GRCm39)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,332,975 (GRCm39)	missense
R9366:Rnf213	UTSW	11	119,327,057 (GRCm39)	missense
R9413:Rnf213	UTSW	11	119,357,059 (GRCm39)	missense
R9444:Rnf213	UTSW	11	119,325,623 (GRCm39)	missense
R9605:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R9649:Rnf213	UTSW	11	119,370,457 (GRCm39)	missense
R9651:Rnf213	UTSW	11	119,331,238 (GRCm39)	missense
R9664:Rnf213	UTSW	11	119,332,794 (GRCm39)	missense
R9696:Rnf213	UTSW	11	119,359,806 (GRCm39)	missense
R9710:Rnf213	UTSW	11	119,331,831 (GRCm39)	missense
R9797:Rnf213	UTSW	11	119,333,365 (GRCm39)	missense
S24628:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,332,650 (GRCm39)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,364,339 (GRCm39)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,331,289 (GRCm39)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,368,080 (GRCm39)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,373,824 (GRCm39)	missense
Z1176:Rnf213	UTSW	11	119,332,236 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TCATAGATACACTGCTGTCCTTG -3'
(R):5'- ACCATAGATGAGCTCCCAGC -3'

Sequencing Primer
(F):5'- GTCCTTGCTCTTCGTACAAAAGGAG -3'
(R):5'- AAATCATGGTCAGCTGCTGC -3'

Posted On

2022-06-15