Incidental Mutation 'R9467:Olfr1008'
ID 715190
Institutional Source Beutler Lab
Gene Symbol Olfr1008
Ensembl Gene ENSMUSG00000050603
Gene Name olfactory receptor 1008
Synonyms MOR187-3, GA_x6K02T2Q125-47170431-47171372
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 85689431-85690372 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 85690282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 284 (M284I)
Ref Sequence ENSEMBL: ENSMUSP00000061191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054868]
AlphaFold Q8VGC7
Predicted Effect
SMART Domains Protein: ENSMUSP00000061191
Gene: ENSMUSG00000050603
AA Change: M284I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-46 PFAM
Pfam:7tm_1 41 290 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,741,314 T1023I probably damaging Het
4933409G03Rik A C 2: 68,593,590 M46L Het
Aars2 A G 17: 45,516,484 E484G probably benign Het
Abcd2 C T 15: 91,191,622 probably benign Het
Acap2 A G 16: 31,111,083 S361P possibly damaging Het
Arap2 T C 5: 62,730,557 E482G probably benign Het
Axin2 G T 11: 108,942,956 L576F possibly damaging Het
B4galt2 T A 4: 117,880,926 Y161F probably damaging Het
Cbwd1 T A 19: 24,953,320 M122L possibly damaging Het
Cdh3 A T 8: 106,539,793 probably null Het
Cfap61 A T 2: 146,129,229 I920F probably benign Het
Chaf1b T C 16: 93,884,506 I4T probably benign Het
Clptm1 T C 7: 19,637,524 N328S probably benign Het
Cthrc1 A G 15: 39,084,294 N136S probably benign Het
Dlec1 G T 9: 119,142,584 R1279L probably damaging Het
Dnah5 A T 15: 28,366,147 T2669S possibly damaging Het
Efcab14 C A 4: 115,753,011 L190I probably damaging Het
Eml6 A T 11: 29,819,076 C690S probably damaging Het
Fignl1 T C 11: 11,801,483 E524G probably damaging Het
Fmo4 A G 1: 162,803,669 V243A probably benign Het
Ghr A G 15: 3,328,024 V254A probably benign Het
Gm21818 C T 13: 120,172,525 probably benign Het
Gm9008 C T 6: 76,496,632 E334K probably benign Het
Igkv8-28 A G 6: 70,143,707 V84A probably damaging Het
Itgb7 T C 15: 102,223,554 D198G probably damaging Het
Klra2 A G 6: 131,220,107 probably null Het
Klrc2 A T 6: 129,656,400 Y230N probably damaging Het
Lacc1 A G 14: 77,029,584 V413A probably damaging Het
Muc16 T C 9: 18,597,035 N6355S probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ncor1 CTG CTGGTG 11: 62,433,622 probably benign Het
Ndn A G 7: 62,349,155 K250E possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5e A G 9: 88,367,363 E450G probably benign Het
Olfr1428 A T 19: 12,108,949 M199K possibly damaging Het
Olfr501-ps1 T A 7: 108,508,583 *176K probably null Het
Palld A G 8: 61,515,230 S1343P unknown Het
Pcdha8 T A 18: 36,993,790 S442T possibly damaging Het
Pole2 T C 12: 69,208,945 I349V probably benign Het
Ptprb C T 10: 116,322,485 T487M probably benign Het
Ptprc C T 1: 138,066,222 D1020N probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Ryr2 T C 13: 11,556,604 N4916S possibly damaging Het
Selp C T 1: 164,130,105 P268S probably damaging Het
Sema7a T A 9: 57,957,325 C333S probably damaging Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,467,582 probably null Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Shisa5 G A 9: 109,038,644 probably benign Het
Snx27 A G 3: 94,582,416 V45A possibly damaging Het
Srcap T C 7: 127,540,359 V1284A probably damaging Het
Ssrp1 A G 2: 85,042,266 D416G probably damaging Het
Tectb A G 19: 55,192,661 Y144C Het
Thap12 G T 7: 98,710,141 V76F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Tsg101 A G 7: 46,909,024 Y80H probably benign Het
Unc5cl T A 17: 48,463,628 M368K probably damaging Het
Utp20 G T 10: 88,804,528 Q717K possibly damaging Het
Vmn1r159 T A 7: 22,842,716 D297V possibly damaging Het
Vmn2r98 G T 17: 19,067,255 S450I probably benign Het
Zbtb8b T C 4: 129,432,526 E282G probably benign Het
Zfp831 T C 2: 174,644,996 V488A probably benign Het
Zzef1 G A 11: 72,916,425 V2710I probably damaging Het
Other mutations in Olfr1008
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr1008 APN 2 85689663 missense probably benign 0.01
IGL02192:Olfr1008 APN 2 85690128 missense possibly damaging 0.80
IGL02560:Olfr1008 APN 2 85689519 missense possibly damaging 0.79
IGL02726:Olfr1008 APN 2 85690210 missense possibly damaging 0.94
IGL02756:Olfr1008 APN 2 85690058 missense probably damaging 0.99
R0463:Olfr1008 UTSW 2 85689839 missense possibly damaging 0.94
R0961:Olfr1008 UTSW 2 85689446 missense probably benign 0.00
R0964:Olfr1008 UTSW 2 85690365 missense probably benign
R1259:Olfr1008 UTSW 2 85689531 missense probably damaging 0.98
R1756:Olfr1008 UTSW 2 85690083 missense probably damaging 1.00
R1871:Olfr1008 UTSW 2 85690311 missense probably damaging 1.00
R1882:Olfr1008 UTSW 2 85689606 missense probably damaging 1.00
R6573:Olfr1008 UTSW 2 85689999 missense probably damaging 0.99
R6640:Olfr1008 UTSW 2 85689935 missense probably damaging 1.00
R6746:Olfr1008 UTSW 2 85689608 missense probably damaging 1.00
R7045:Olfr1008 UTSW 2 85689911 missense possibly damaging 0.49
R7347:Olfr1008 UTSW 2 85689837 missense probably damaging 0.99
R7875:Olfr1008 UTSW 2 85689494 missense probably benign 0.14
R8030:Olfr1008 UTSW 2 85689719 missense probably damaging 1.00
R9161:Olfr1008 UTSW 2 85689887 missense probably benign 0.01
R9193:Olfr1008 UTSW 2 85690300 nonsense probably null
R9399:Olfr1008 UTSW 2 85690051 missense probably damaging 0.97
R9460:Olfr1008 UTSW 2 85690015 missense probably benign 0.02
R9685:Olfr1008 UTSW 2 85689522 missense probably damaging 1.00
Z1177:Olfr1008 UTSW 2 85689680 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGATTATATGTCCTGATTCTGATAGCC -3'
(R):5'- TGAGATGAGAAAAGTCCAAGTTGTC -3'

Sequencing Primer
(F):5'- AGCCATATGTCGAATGCATTCTGC -3'
(R):5'- TGAGAAAAGTCCAAGTTGTCATAGTG -3'
Posted On 2022-06-15