Incidental Mutation 'R9467:B4galt2'
ID 715195
Institutional Source Beutler Lab
Gene Symbol B4galt2
Ensembl Gene ENSMUSG00000028541
Gene Name UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 117869260-117883487 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117880926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 161 (Y161F)
Ref Sequence ENSEMBL: ENSMUSP00000030266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000036380] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000132073] [ENSMUST00000149868] [ENSMUST00000150204] [ENSMUST00000153358] [ENSMUST00000167443] [ENSMUST00000171548]
AlphaFold Q9Z2Y2
Predicted Effect probably damaging
Transcript: ENSMUST00000030266
AA Change: Y161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541
AA Change: Y161F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036380
SMART Domains Protein: ENSMUSP00000047682
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ATP-synt_C 50 112 1.2e-15 PFAM
Pfam:ATP-synt_C 136 198 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084325
AA Change: Y161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541
AA Change: Y161F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106421
AA Change: Y161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541
AA Change: Y161F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132073
SMART Domains Protein: ENSMUSP00000137654
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149868
SMART Domains Protein: ENSMUSP00000137788
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 3.1e-19 PFAM
transmembrane domain 84 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150204
SMART Domains Protein: ENSMUSP00000119988
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 8.2e-19 PFAM
Pfam:ATP-synt_C 88 152 1.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153358
AA Change: Y161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120571
Gene: ENSMUSG00000028541
AA Change: Y161F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 197 9.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167443
AA Change: Y161F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541
AA Change: Y161F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171548
SMART Domains Protein: ENSMUSP00000126539
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased brain weight, ectopic Purkinje cells in the cerebellum, and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,741,314 T1023I probably damaging Het
4933409G03Rik A C 2: 68,593,590 M46L Het
Aars2 A G 17: 45,516,484 E484G probably benign Het
Abcd2 C T 15: 91,191,622 probably benign Het
Acap2 A G 16: 31,111,083 S361P possibly damaging Het
Arap2 T C 5: 62,730,557 E482G probably benign Het
Axin2 G T 11: 108,942,956 L576F possibly damaging Het
Cbwd1 T A 19: 24,953,320 M122L possibly damaging Het
Cdh3 A T 8: 106,539,793 probably null Het
Cfap61 A T 2: 146,129,229 I920F probably benign Het
Chaf1b T C 16: 93,884,506 I4T probably benign Het
Clptm1 T C 7: 19,637,524 N328S probably benign Het
Cthrc1 A G 15: 39,084,294 N136S probably benign Het
Dlec1 G T 9: 119,142,584 R1279L probably damaging Het
Dnah5 A T 15: 28,366,147 T2669S possibly damaging Het
Efcab14 C A 4: 115,753,011 L190I probably damaging Het
Eml6 A T 11: 29,819,076 C690S probably damaging Het
Fignl1 T C 11: 11,801,483 E524G probably damaging Het
Fmo4 A G 1: 162,803,669 V243A probably benign Het
Ghr A G 15: 3,328,024 V254A probably benign Het
Gm21818 C T 13: 120,172,525 probably benign Het
Gm9008 C T 6: 76,496,632 E334K probably benign Het
Igkv8-28 A G 6: 70,143,707 V84A probably damaging Het
Itgb7 T C 15: 102,223,554 D198G probably damaging Het
Klra2 A G 6: 131,220,107 probably null Het
Klrc2 A T 6: 129,656,400 Y230N probably damaging Het
Lacc1 A G 14: 77,029,584 V413A probably damaging Het
Muc16 T C 9: 18,597,035 N6355S probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ncor1 CTG CTGGTG 11: 62,433,622 probably benign Het
Ndn A G 7: 62,349,155 K250E possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5e A G 9: 88,367,363 E450G probably benign Het
Olfr1008 G T 2: 85,690,282 M284I Het
Olfr1428 A T 19: 12,108,949 M199K possibly damaging Het
Olfr501-ps1 T A 7: 108,508,583 *176K probably null Het
Palld A G 8: 61,515,230 S1343P unknown Het
Pcdha8 T A 18: 36,993,790 S442T possibly damaging Het
Pole2 T C 12: 69,208,945 I349V probably benign Het
Ptprb C T 10: 116,322,485 T487M probably benign Het
Ptprc C T 1: 138,066,222 D1020N probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Ryr2 T C 13: 11,556,604 N4916S possibly damaging Het
Selp C T 1: 164,130,105 P268S probably damaging Het
Sema7a T A 9: 57,957,325 C333S probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,467,582 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Shisa5 G A 9: 109,038,644 probably benign Het
Snx27 A G 3: 94,582,416 V45A possibly damaging Het
Srcap T C 7: 127,540,359 V1284A probably damaging Het
Ssrp1 A G 2: 85,042,266 D416G probably damaging Het
Tectb A G 19: 55,192,661 Y144C Het
Thap12 G T 7: 98,710,141 V76F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Tsg101 A G 7: 46,909,024 Y80H probably benign Het
Unc5cl T A 17: 48,463,628 M368K probably damaging Het
Utp20 G T 10: 88,804,528 Q717K possibly damaging Het
Vmn1r159 T A 7: 22,842,716 D297V possibly damaging Het
Vmn2r98 G T 17: 19,067,255 S450I probably benign Het
Zbtb8b T C 4: 129,432,526 E282G probably benign Het
Zfp831 T C 2: 174,644,996 V488A probably benign Het
Zzef1 G A 11: 72,916,425 V2710I probably damaging Het
Other mutations in B4galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:B4galt2 APN 4 117877181 missense probably damaging 0.99
IGL02207:B4galt2 APN 4 117881521 missense probably damaging 1.00
IGL02224:B4galt2 APN 4 117876913 missense probably benign 0.00
IGL02724:B4galt2 APN 4 117876878 critical splice donor site probably null
IGL02949:B4galt2 APN 4 117881405 missense probably benign 0.05
R1164:B4galt2 UTSW 4 117876944 missense possibly damaging 0.96
R1534:B4galt2 UTSW 4 117877472 missense probably damaging 1.00
R4715:B4galt2 UTSW 4 117877179 missense possibly damaging 0.92
R5640:B4galt2 UTSW 4 117873998 missense probably benign
R6492:B4galt2 UTSW 4 117876967 missense probably damaging 0.99
R6974:B4galt2 UTSW 4 117873951 missense probably damaging 0.98
R7126:B4galt2 UTSW 4 117877538 missense probably damaging 1.00
R9220:B4galt2 UTSW 4 117877202 missense probably damaging 1.00
Z1177:B4galt2 UTSW 4 117881069 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAACCACAGCTTTCTCCAG -3'
(R):5'- TGACACTGTCCTGTCTGCAG -3'

Sequencing Primer
(F):5'- ACAGCTTTCTCCAGCCCTGAG -3'
(R):5'- AGTGGGCCGAGTGGTCATC -3'
Posted On 2022-06-15