Incidental Mutation 'R9467:Zbtb8b'
ID 715196
Institutional Source Beutler Lab
Gene Symbol Zbtb8b
Ensembl Gene ENSMUSG00000048485
Gene Name zinc finger and BTB domain containing 8b
Synonyms MGC:38362
Accession Numbers

Genbank: NM_153541; MGI: 2387181

Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 129425765-129440853 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129432526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 282 (E282G)
Ref Sequence ENSEMBL: ENSMUSP00000101661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053042] [ENSMUST00000106046]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000053042
AA Change: E249G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058157
Gene: ENSMUSG00000048485
AA Change: E249G

DomainStartEndE-ValueType
BTB 24 122 1.89e-25 SMART
low complexity region 132 149 N/A INTRINSIC
ZnF_C2H2 331 353 1.12e-3 SMART
ZnF_C2H2 359 382 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106046
AA Change: E282G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101661
Gene: ENSMUSG00000048485
AA Change: E282G

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
BTB 57 155 1.89e-25 SMART
low complexity region 165 182 N/A INTRINSIC
ZnF_C2H2 364 386 1.12e-3 SMART
ZnF_C2H2 392 415 1.95e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,741,314 T1023I probably damaging Het
4933409G03Rik A C 2: 68,593,590 M46L Het
Aars2 A G 17: 45,516,484 E484G probably benign Het
Abcd2 C T 15: 91,191,622 probably benign Het
Acap2 A G 16: 31,111,083 S361P possibly damaging Het
Arap2 T C 5: 62,730,557 E482G probably benign Het
Axin2 G T 11: 108,942,956 L576F possibly damaging Het
B4galt2 T A 4: 117,880,926 Y161F probably damaging Het
Cbwd1 T A 19: 24,953,320 M122L possibly damaging Het
Cdh3 A T 8: 106,539,793 probably null Het
Cfap61 A T 2: 146,129,229 I920F probably benign Het
Chaf1b T C 16: 93,884,506 I4T probably benign Het
Clptm1 T C 7: 19,637,524 N328S probably benign Het
Cthrc1 A G 15: 39,084,294 N136S probably benign Het
Dlec1 G T 9: 119,142,584 R1279L probably damaging Het
Dnah5 A T 15: 28,366,147 T2669S possibly damaging Het
Efcab14 C A 4: 115,753,011 L190I probably damaging Het
Eml6 A T 11: 29,819,076 C690S probably damaging Het
Fignl1 T C 11: 11,801,483 E524G probably damaging Het
Fmo4 A G 1: 162,803,669 V243A probably benign Het
Ghr A G 15: 3,328,024 V254A probably benign Het
Gm21818 C T 13: 120,172,525 probably benign Het
Gm9008 C T 6: 76,496,632 E334K probably benign Het
Igkv8-28 A G 6: 70,143,707 V84A probably damaging Het
Itgb7 T C 15: 102,223,554 D198G probably damaging Het
Klra2 A G 6: 131,220,107 probably null Het
Klrc2 A T 6: 129,656,400 Y230N probably damaging Het
Lacc1 A G 14: 77,029,584 V413A probably damaging Het
Muc16 T C 9: 18,597,035 N6355S probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ncor1 CTG CTGGTG 11: 62,433,622 probably benign Het
Ndn A G 7: 62,349,155 K250E possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5e A G 9: 88,367,363 E450G probably benign Het
Olfr1008 G T 2: 85,690,282 M284I Het
Olfr1428 A T 19: 12,108,949 M199K possibly damaging Het
Olfr501-ps1 T A 7: 108,508,583 *176K probably null Het
Palld A G 8: 61,515,230 S1343P unknown Het
Pcdha8 T A 18: 36,993,790 S442T possibly damaging Het
Pole2 T C 12: 69,208,945 I349V probably benign Het
Ptprb C T 10: 116,322,485 T487M probably benign Het
Ptprc C T 1: 138,066,222 D1020N probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Ryr2 T C 13: 11,556,604 N4916S possibly damaging Het
Selp C T 1: 164,130,105 P268S probably damaging Het
Sema7a T A 9: 57,957,325 C333S probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,467,582 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Shisa5 G A 9: 109,038,644 probably benign Het
Snx27 A G 3: 94,582,416 V45A possibly damaging Het
Srcap T C 7: 127,540,359 V1284A probably damaging Het
Ssrp1 A G 2: 85,042,266 D416G probably damaging Het
Tectb A G 19: 55,192,661 Y144C Het
Thap12 G T 7: 98,710,141 V76F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Tsg101 A G 7: 46,909,024 Y80H probably benign Het
Unc5cl T A 17: 48,463,628 M368K probably damaging Het
Utp20 G T 10: 88,804,528 Q717K possibly damaging Het
Vmn1r159 T A 7: 22,842,716 D297V possibly damaging Het
Vmn2r98 G T 17: 19,067,255 S450I probably benign Het
Zfp831 T C 2: 174,644,996 V488A probably benign Het
Zzef1 G A 11: 72,916,425 V2710I probably damaging Het
Other mutations in Zbtb8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zbtb8b APN 4 129433259 missense probably damaging 0.96
IGL01989:Zbtb8b APN 4 129432388 missense probably damaging 1.00
IGL03332:Zbtb8b APN 4 129428568 missense probably damaging 1.00
N/A:Zbtb8b UTSW 4 129432568 missense probably benign
PIT4131001:Zbtb8b UTSW 4 129427515 makesense probably null
R0391:Zbtb8b UTSW 4 129432670 missense probably damaging 1.00
R2389:Zbtb8b UTSW 4 129433273 missense probably benign 0.25
R2392:Zbtb8b UTSW 4 129433189 missense probably damaging 1.00
R2760:Zbtb8b UTSW 4 129432500 missense probably benign 0.04
R5028:Zbtb8b UTSW 4 129433000 missense probably damaging 1.00
R5572:Zbtb8b UTSW 4 129428541 missense probably damaging 1.00
R6029:Zbtb8b UTSW 4 129428493 missense probably damaging 1.00
R6671:Zbtb8b UTSW 4 129427784 missense probably damaging 0.99
R6714:Zbtb8b UTSW 4 129432983 missense probably damaging 1.00
R7039:Zbtb8b UTSW 4 129427685 missense possibly damaging 0.48
R7392:Zbtb8b UTSW 4 129432890 missense probably benign 0.01
R7454:Zbtb8b UTSW 4 129432769 missense possibly damaging 0.75
R7634:Zbtb8b UTSW 4 129432962 missense probably damaging 1.00
R8017:Zbtb8b UTSW 4 129428445 missense probably damaging 1.00
R8444:Zbtb8b UTSW 4 129432631 missense probably benign
R9366:Zbtb8b UTSW 4 129432358 missense probably benign 0.01
R9417:Zbtb8b UTSW 4 129432724 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCACGGAACTCATGGCCAC -3'
(R):5'- GCACCAAGAGCTTTGTCTCCTC -3'

Sequencing Primer
(F):5'- AACTCATGGCCACTCCTGG -3'
(R):5'- GGGAGTCTAGACTGTACAATATCATC -3'
Posted On 2022-06-15