Mutagenetix > Incidental Mutation

Incidental Mutation 'R9467:Eml6'

715224

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R9467 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 29819076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 690 (C690S)

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]

AlphaFold

Q5SQM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000058902
AA Change: C690S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: C690S

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000104962

SMART Domains

Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157

Domain	Start	End	E-Value	Type
ANK	19	50	1.53e3	SMART
ANK	57	87	1.7e-3	SMART
ANK	99	128	3.6e-2	SMART
ANK	132	162	3.31e-1	SMART
ANK	166	195	8.19e-6	SMART
ANK	199	228	7.83e-3	SMART
ANK	231	260	1.8e-2	SMART
low complexity region	297	306	N/A	INTRINSIC
low complexity region	434	445	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
ANK	536	578	8.39e-3	SMART
ANK	582	611	3.91e-3	SMART

Predicted Effect

silent
Transcript: ENSMUST00000109452

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	T	1: 105,741,314	T1023I	probably damaging	Het
4933409G03Rik	A	C	2: 68,593,590	M46L		Het
Aars2	A	G	17: 45,516,484	E484G	probably benign	Het
Abcd2	C	T	15: 91,191,622		probably benign	Het
Acap2	A	G	16: 31,111,083	S361P	possibly damaging	Het
Arap2	T	C	5: 62,730,557	E482G	probably benign	Het
Axin2	G	T	11: 108,942,956	L576F	possibly damaging	Het
B4galt2	T	A	4: 117,880,926	Y161F	probably damaging	Het
Cbwd1	T	A	19: 24,953,320	M122L	possibly damaging	Het
Cdh3	A	T	8: 106,539,793		probably null	Het
Cfap61	A	T	2: 146,129,229	I920F	probably benign	Het
Chaf1b	T	C	16: 93,884,506	I4T	probably benign	Het
Clptm1	T	C	7: 19,637,524	N328S	probably benign	Het
Cthrc1	A	G	15: 39,084,294	N136S	probably benign	Het
Dlec1	G	T	9: 119,142,584	R1279L	probably damaging	Het
Dnah5	A	T	15: 28,366,147	T2669S	possibly damaging	Het
Efcab14	C	A	4: 115,753,011	L190I	probably damaging	Het
Fignl1	T	C	11: 11,801,483	E524G	probably damaging	Het
Fmo4	A	G	1: 162,803,669	V243A	probably benign	Het
Ghr	A	G	15: 3,328,024	V254A	probably benign	Het
Gm21818	C	T	13: 120,172,525		probably benign	Het
Gm9008	C	T	6: 76,496,632	E334K	probably benign	Het
Igkv8-28	A	G	6: 70,143,707	V84A	probably damaging	Het
Itgb7	T	C	15: 102,223,554	D198G	probably damaging	Het
Klra2	A	G	6: 131,220,107		probably null	Het
Klrc2	A	T	6: 129,656,400	Y230N	probably damaging	Het
Lacc1	A	G	14: 77,029,584	V413A	probably damaging	Het
Muc16	T	C	9: 18,597,035	N6355S	probably benign	Het
Ncor1	AGCTGCTGCTGCTGCTGCTGCTGCTG	AGCTGCTGCTGCTGCTGCTGCTGCTGCTG	11: 62,433,611		probably benign	Het
Ncor1	CTG	CTGGTG	11: 62,433,622		probably benign	Het
Ndn	A	G	7: 62,349,155	K250E	possibly damaging	Het
Nicn1	C	T	9: 108,294,509	R163C	possibly damaging	Het
Nt5e	A	G	9: 88,367,363	E450G	probably benign	Het
Olfr1008	G	T	2: 85,690,282	M284I		Het
Olfr1428	A	T	19: 12,108,949	M199K	possibly damaging	Het
Olfr501-ps1	T	A	7: 108,508,583	*176K	probably null	Het
Palld	A	G	8: 61,515,230	S1343P	unknown	Het
Pcdha8	T	A	18: 36,993,790	S442T	possibly damaging	Het
Pole2	T	C	12: 69,208,945	I349V	probably benign	Het
Ptprb	C	T	10: 116,322,485	T487M	probably benign	Het
Ptprc	C	T	1: 138,066,222	D1020N	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGACGGCGGCG	7: 97,579,913		probably benign	Het
Ryr2	T	C	13: 11,556,604	N4916S	possibly damaging	Het
Selp	C	T	1: 164,130,105	P268S	probably damaging	Het
Sema7a	T	A	9: 57,957,325	C333S	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	CAGCCACGGGGACCAGCT	CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT	7: 126,467,582		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Shisa5	G	A	9: 109,038,644		probably benign	Het
Snx27	A	G	3: 94,582,416	V45A	possibly damaging	Het
Srcap	T	C	7: 127,540,359	V1284A	probably damaging	Het
Ssrp1	A	G	2: 85,042,266	D416G	probably damaging	Het
Tectb	A	G	19: 55,192,661	Y144C		Het
Thap12	G	T	7: 98,710,141	V76F	probably damaging	Het
Ticam2	G	C	18: 46,560,681	P113R	probably damaging	Het
Tsg101	A	G	7: 46,909,024	Y80H	probably benign	Het
Unc5cl	T	A	17: 48,463,628	M368K	probably damaging	Het
Utp20	G	T	10: 88,804,528	Q717K	possibly damaging	Het
Vmn1r159	T	A	7: 22,842,716	D297V	possibly damaging	Het
Vmn2r98	G	T	17: 19,067,255	S450I	probably benign	Het
Zbtb8b	T	C	4: 129,432,526	E282G	probably benign	Het
Zfp831	T	C	2: 174,644,996	V488A	probably benign	Het
Zzef1	G	A	11: 72,916,425	V2710I	probably damaging	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
PIT4453001:Eml6	UTSW	11	29802489	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0766:Eml6	UTSW	11	29831219	splice site	probably benign
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6239:Eml6	UTSW	11	29749275	missense	probably damaging	1.00
R6326:Eml6	UTSW	11	29819066	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6753:Eml6	UTSW	11	29754987	missense	probably damaging	1.00
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9481:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9534:Eml6	UTSW	11	29784155	missense	possibly damaging	0.45
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CATTGAGGAGAGACACATACCTG -3'
(R):5'- TGAACAAGGATTGCTTTTGGC -3'

Sequencing Primer
(F):5'- ATACCTGTCCAGTGGCTACATAG -3'
(R):5'- ACATAGATAGTAGTTGAAGGTCTGC -3'

Posted On

2022-06-15