Incidental Mutation 'R9467:Pole2'
ID 715229
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 69248547-69274969 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69255719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 349 (I349V)
Ref Sequence ENSEMBL: ENSMUSP00000021359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: I349V

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: I349V

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,423,934 (GRCm39) M46L Het
Aars2 A G 17: 45,827,410 (GRCm39) E484G probably benign Het
Abcd2 C T 15: 91,075,825 (GRCm39) probably benign Het
Acap2 A G 16: 30,929,901 (GRCm39) S361P possibly damaging Het
Arap2 T C 5: 62,887,900 (GRCm39) E482G probably benign Het
Axin2 G T 11: 108,833,782 (GRCm39) L576F possibly damaging Het
B4galt2 T A 4: 117,738,123 (GRCm39) Y161F probably damaging Het
Cdh3 A T 8: 107,266,425 (GRCm39) probably null Het
Cfap61 A T 2: 145,971,149 (GRCm39) I920F probably benign Het
Chaf1b T C 16: 93,681,394 (GRCm39) I4T probably benign Het
Clptm1 T C 7: 19,371,449 (GRCm39) N328S probably benign Het
Cthrc1 A G 15: 38,947,689 (GRCm39) N136S probably benign Het
Dlec1 G T 9: 118,971,652 (GRCm39) R1279L probably damaging Het
Dnah5 A T 15: 28,366,293 (GRCm39) T2669S possibly damaging Het
Efcab14 C A 4: 115,610,208 (GRCm39) L190I probably damaging Het
Eml6 A T 11: 29,769,076 (GRCm39) C690S probably damaging Het
Fignl1 T C 11: 11,751,483 (GRCm39) E524G probably damaging Het
Fmo4 A G 1: 162,631,238 (GRCm39) V243A probably benign Het
Ghr A G 15: 3,357,506 (GRCm39) V254A probably benign Het
Igkv8-28 A G 6: 70,120,691 (GRCm39) V84A probably damaging Het
Itgb7 T C 15: 102,131,989 (GRCm39) D198G probably damaging Het
Klra2 A G 6: 131,197,070 (GRCm39) probably null Het
Klrc2 A T 6: 129,633,363 (GRCm39) Y230N probably damaging Het
Lacc1 A G 14: 77,267,024 (GRCm39) V413A probably damaging Het
Muc16 T C 9: 18,508,331 (GRCm39) N6355S probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,324,437 (GRCm39) probably benign Het
Ncor1 CTG CTGGTG 11: 62,324,448 (GRCm39) probably benign Het
Ndn A G 7: 61,998,903 (GRCm39) K250E possibly damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nt5e A G 9: 88,249,416 (GRCm39) E450G probably benign Het
Or4d6 A T 19: 12,086,313 (GRCm39) M199K possibly damaging Het
Or5p75-ps1 T A 7: 108,107,790 (GRCm39) *176K probably null Het
Or8k16 G T 2: 85,520,626 (GRCm39) M284I Het
Palld A G 8: 61,968,264 (GRCm39) S1343P unknown Het
Pcdha8 T A 18: 37,126,843 (GRCm39) S442T possibly damaging Het
Ptprb C T 10: 116,158,390 (GRCm39) T487M probably benign Het
Ptprc C T 1: 137,993,960 (GRCm39) D1020N probably damaging Het
Relch C T 1: 105,669,039 (GRCm39) T1023I probably damaging Het
Rnf26rt C T 6: 76,473,615 (GRCm39) E334K probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,229,120 (GRCm39) probably benign Het
Ryr2 T C 13: 11,571,490 (GRCm39) N4916S possibly damaging Het
Selp C T 1: 163,957,674 (GRCm39) P268S probably damaging Het
Sema7a T A 9: 57,864,608 (GRCm39) C333S probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,066,754 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Shisa5 G A 9: 108,867,712 (GRCm39) probably benign Het
Snx27 A G 3: 94,489,723 (GRCm39) V45A possibly damaging Het
Srcap T C 7: 127,139,531 (GRCm39) V1284A probably damaging Het
Ssrp1 A G 2: 84,872,610 (GRCm39) D416G probably damaging Het
Tcstv1b C T 13: 120,634,061 (GRCm39) probably benign Het
Tectb A G 19: 55,181,093 (GRCm39) Y144C Het
Thap12 G T 7: 98,359,348 (GRCm39) V76F probably damaging Het
Ticam2 G C 18: 46,693,748 (GRCm39) P113R probably damaging Het
Tsg101 A G 7: 46,558,772 (GRCm39) Y80H probably benign Het
Unc5cl T A 17: 48,770,656 (GRCm39) M368K probably damaging Het
Utp20 G T 10: 88,640,390 (GRCm39) Q717K possibly damaging Het
Vmn1r159 T A 7: 22,542,141 (GRCm39) D297V possibly damaging Het
Vmn2r98 G T 17: 19,287,517 (GRCm39) S450I probably benign Het
Zbtb8b T C 4: 129,326,319 (GRCm39) E282G probably benign Het
Zfp831 T C 2: 174,486,789 (GRCm39) V488A probably benign Het
Zng1 T A 19: 24,930,684 (GRCm39) M122L possibly damaging Het
Zzef1 G A 11: 72,807,251 (GRCm39) V2710I probably damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69,273,219 (GRCm39) splice site probably benign
IGL00940:Pole2 APN 12 69,262,134 (GRCm39) missense probably damaging 1.00
IGL01593:Pole2 APN 12 69,269,873 (GRCm39) splice site probably null
IGL01609:Pole2 APN 12 69,254,631 (GRCm39) critical splice donor site probably null
IGL01717:Pole2 APN 12 69,260,623 (GRCm39) missense probably damaging 1.00
IGL02168:Pole2 APN 12 69,248,660 (GRCm39) unclassified probably benign
IGL02208:Pole2 APN 12 69,269,936 (GRCm39) missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69,256,649 (GRCm39) missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69,256,759 (GRCm39) nonsense probably null
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0396:Pole2 UTSW 12 69,269,160 (GRCm39) splice site probably benign
R0574:Pole2 UTSW 12 69,258,231 (GRCm39) splice site probably benign
R0620:Pole2 UTSW 12 69,256,653 (GRCm39) missense probably damaging 1.00
R0685:Pole2 UTSW 12 69,258,187 (GRCm39) missense probably damaging 0.98
R0791:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1452:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1453:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1455:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1912:Pole2 UTSW 12 69,256,764 (GRCm39) missense probably damaging 0.99
R2067:Pole2 UTSW 12 69,274,926 (GRCm39) missense probably benign 0.01
R2929:Pole2 UTSW 12 69,256,712 (GRCm39) missense probably benign 0.13
R3016:Pole2 UTSW 12 69,268,836 (GRCm39) missense probably benign 0.14
R4504:Pole2 UTSW 12 69,269,242 (GRCm39) missense probably benign 0.00
R4765:Pole2 UTSW 12 69,268,826 (GRCm39) missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69,273,139 (GRCm39) missense probably benign 0.00
R4896:Pole2 UTSW 12 69,269,924 (GRCm39) missense probably damaging 0.97
R6998:Pole2 UTSW 12 69,260,680 (GRCm39) missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69,249,684 (GRCm39) missense probably damaging 1.00
R7535:Pole2 UTSW 12 69,269,203 (GRCm39) missense probably benign 0.10
R7841:Pole2 UTSW 12 69,251,032 (GRCm39) missense probably damaging 1.00
R8437:Pole2 UTSW 12 69,250,961 (GRCm39) nonsense probably null
R8506:Pole2 UTSW 12 69,255,734 (GRCm39) missense probably benign
R9494:Pole2 UTSW 12 69,249,731 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCCTGGGATCAACTTGTTCTC -3'
(R):5'- GGCTTTGAAAGGTATTGAGCATC -3'

Sequencing Primer
(F):5'- CACTATAGATGGTTGTGAGCCACC -3'
(R):5'- AAGAGTGTTTCCAATCCCGG -3'
Posted On 2022-06-15