Incidental Mutation 'R9467:Dnah5'
ID 715234
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 28203752-28472052 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28366147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 2669 (T2669S)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000067048
AA Change: T2669S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: T2669S

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,741,314 (GRCm38) T1023I probably damaging Het
4933409G03Rik A C 2: 68,593,590 (GRCm38) M46L Het
Aars2 A G 17: 45,516,484 (GRCm38) E484G probably benign Het
Abcd2 C T 15: 91,191,622 (GRCm38) probably benign Het
Acap2 A G 16: 31,111,083 (GRCm38) S361P possibly damaging Het
Arap2 T C 5: 62,730,557 (GRCm38) E482G probably benign Het
Axin2 G T 11: 108,942,956 (GRCm38) L576F possibly damaging Het
B4galt2 T A 4: 117,880,926 (GRCm38) Y161F probably damaging Het
Cbwd1 T A 19: 24,953,320 (GRCm38) M122L possibly damaging Het
Cdh3 A T 8: 106,539,793 (GRCm38) probably null Het
Cfap61 A T 2: 146,129,229 (GRCm38) I920F probably benign Het
Chaf1b T C 16: 93,884,506 (GRCm38) I4T probably benign Het
Clptm1 T C 7: 19,637,524 (GRCm38) N328S probably benign Het
Cthrc1 A G 15: 39,084,294 (GRCm38) N136S probably benign Het
Dlec1 G T 9: 119,142,584 (GRCm38) R1279L probably damaging Het
Efcab14 C A 4: 115,753,011 (GRCm38) L190I probably damaging Het
Eml6 A T 11: 29,819,076 (GRCm38) C690S probably damaging Het
Fignl1 T C 11: 11,801,483 (GRCm38) E524G probably damaging Het
Fmo4 A G 1: 162,803,669 (GRCm38) V243A probably benign Het
Ghr A G 15: 3,328,024 (GRCm38) V254A probably benign Het
Gm21818 C T 13: 120,172,525 (GRCm38) probably benign Het
Gm9008 C T 6: 76,496,632 (GRCm38) E334K probably benign Het
Igkv8-28 A G 6: 70,143,707 (GRCm38) V84A probably damaging Het
Itgb7 T C 15: 102,223,554 (GRCm38) D198G probably damaging Het
Klra2 A G 6: 131,220,107 (GRCm38) probably null Het
Klrc2 A T 6: 129,656,400 (GRCm38) Y230N probably damaging Het
Lacc1 A G 14: 77,029,584 (GRCm38) V413A probably damaging Het
Muc16 T C 9: 18,597,035 (GRCm38) N6355S probably benign Het
Ncor1 CTG CTGGTG 11: 62,433,622 (GRCm38) probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 (GRCm38) probably benign Het
Ndn A G 7: 62,349,155 (GRCm38) K250E possibly damaging Het
Nicn1 C T 9: 108,294,509 (GRCm38) R163C possibly damaging Het
Nt5e A G 9: 88,367,363 (GRCm38) E450G probably benign Het
Olfr1008 G T 2: 85,690,282 (GRCm38) M284I Het
Olfr1428 A T 19: 12,108,949 (GRCm38) M199K possibly damaging Het
Olfr501-ps1 T A 7: 108,508,583 (GRCm38) *176K probably null Het
Palld A G 8: 61,515,230 (GRCm38) S1343P unknown Het
Pcdha8 T A 18: 36,993,790 (GRCm38) S442T possibly damaging Het
Pole2 T C 12: 69,208,945 (GRCm38) I349V probably benign Het
Ptprb C T 10: 116,322,485 (GRCm38) T487M probably benign Het
Ptprc C T 1: 138,066,222 (GRCm38) D1020N probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 (GRCm38) probably benign Het
Ryr2 T C 13: 11,556,604 (GRCm38) N4916S possibly damaging Het
Selp C T 1: 164,130,105 (GRCm38) P268S probably damaging Het
Sema7a T A 9: 57,957,325 (GRCm38) C333S probably damaging Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,467,582 (GRCm38) probably null Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 (GRCm38) probably benign Het
Shank1 G A 7: 44,312,918 (GRCm38) S71N unknown Het
Shisa5 G A 9: 109,038,644 (GRCm38) probably benign Het
Snx27 A G 3: 94,582,416 (GRCm38) V45A possibly damaging Het
Srcap T C 7: 127,540,359 (GRCm38) V1284A probably damaging Het
Ssrp1 A G 2: 85,042,266 (GRCm38) D416G probably damaging Het
Tectb A G 19: 55,192,661 (GRCm38) Y144C Het
Thap12 G T 7: 98,710,141 (GRCm38) V76F probably damaging Het
Ticam2 G C 18: 46,560,681 (GRCm38) P113R probably damaging Het
Tsg101 A G 7: 46,909,024 (GRCm38) Y80H probably benign Het
Unc5cl T A 17: 48,463,628 (GRCm38) M368K probably damaging Het
Utp20 G T 10: 88,804,528 (GRCm38) Q717K possibly damaging Het
Vmn1r159 T A 7: 22,842,716 (GRCm38) D297V possibly damaging Het
Vmn2r98 G T 17: 19,067,255 (GRCm38) S450I probably benign Het
Zbtb8b T C 4: 129,432,526 (GRCm38) E282G probably benign Het
Zfp831 T C 2: 174,644,996 (GRCm38) V488A probably benign Het
Zzef1 G A 11: 72,916,425 (GRCm38) V2710I probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28,272,342 (GRCm38) missense probably benign
IGL00331:Dnah5 APN 15 28,421,620 (GRCm38) missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28,444,218 (GRCm38) missense probably benign 0.10
IGL00537:Dnah5 APN 15 28,458,702 (GRCm38) critical splice donor site probably null
IGL01102:Dnah5 APN 15 28,410,003 (GRCm38) critical splice donor site probably null
IGL01126:Dnah5 APN 15 28,302,399 (GRCm38) missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28,458,656 (GRCm38) missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28,294,913 (GRCm38) splice site probably benign
IGL01353:Dnah5 APN 15 28,233,272 (GRCm38) missense probably benign 0.00
IGL01372:Dnah5 APN 15 28,230,490 (GRCm38) missense probably benign 0.00
IGL01390:Dnah5 APN 15 28,411,540 (GRCm38) missense probably benign 0.00
IGL01446:Dnah5 APN 15 28,326,669 (GRCm38) missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28,331,726 (GRCm38) missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28,229,652 (GRCm38) missense probably benign 0.01
IGL01592:Dnah5 APN 15 28,236,637 (GRCm38) missense probably benign 0.01
IGL01594:Dnah5 APN 15 28,311,334 (GRCm38) missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28,367,782 (GRCm38) missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28,449,169 (GRCm38) missense probably benign 0.06
IGL01904:Dnah5 APN 15 28,307,364 (GRCm38) missense probably benign 0.09
IGL01913:Dnah5 APN 15 28,313,753 (GRCm38) missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28,290,289 (GRCm38) missense probably null 1.00
IGL01963:Dnah5 APN 15 28,370,536 (GRCm38) missense probably benign 0.12
IGL02008:Dnah5 APN 15 28,343,552 (GRCm38) missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28,459,118 (GRCm38) critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28,240,041 (GRCm38) splice site probably benign
IGL02114:Dnah5 APN 15 28,397,124 (GRCm38) missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28,247,885 (GRCm38) missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28,299,240 (GRCm38) missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28,340,381 (GRCm38) missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28,219,150 (GRCm38) missense probably benign 0.09
IGL02626:Dnah5 APN 15 28,307,276 (GRCm38) missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28,289,047 (GRCm38) splice site probably benign
IGL02651:Dnah5 APN 15 28,350,622 (GRCm38) missense probably benign 0.05
IGL02652:Dnah5 APN 15 28,366,187 (GRCm38) missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28,409,296 (GRCm38) missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28,445,143 (GRCm38) missense probably benign 0.00
IGL02721:Dnah5 APN 15 28,234,243 (GRCm38) critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28,453,212 (GRCm38) missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28,383,625 (GRCm38) missense probably benign 0.01
IGL02945:Dnah5 APN 15 28,270,426 (GRCm38) missense probably benign 0.00
IGL02949:Dnah5 APN 15 28,272,185 (GRCm38) missense probably benign 0.32
IGL02971:Dnah5 APN 15 28,384,461 (GRCm38) missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28,340,325 (GRCm38) missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28,295,399 (GRCm38) missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28,290,163 (GRCm38) missense probably benign 0.08
IGL03224:Dnah5 APN 15 28,459,154 (GRCm38) missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28,311,148 (GRCm38) missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28,458,649 (GRCm38) missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28,233,295 (GRCm38) critical splice donor site probably null
IGL03331:Dnah5 APN 15 28,419,940 (GRCm38) missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28,290,141 (GRCm38) missense probably benign 0.10
IGL03367:Dnah5 APN 15 28,234,327 (GRCm38) missense possibly damaging 0.95
Firtel UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
lowbar UTSW 15 28,311,133 (GRCm38) splice site probably null
notherone UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
scheffler UTSW 15 28,438,091 (GRCm38) splice site probably benign
IGL02837:Dnah5 UTSW 15 28,269,400 (GRCm38) missense probably benign
P0008:Dnah5 UTSW 15 28,302,387 (GRCm38) missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28,403,473 (GRCm38) missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28,383,577 (GRCm38) missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28,451,517 (GRCm38) missense probably benign 0.34
R0087:Dnah5 UTSW 15 28,350,613 (GRCm38) missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28,239,934 (GRCm38) missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0102:Dnah5 UTSW 15 28,245,751 (GRCm38) splice site probably benign
R0104:Dnah5 UTSW 15 28,453,353 (GRCm38) missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28,263,679 (GRCm38) missense probably benign 0.00
R0122:Dnah5 UTSW 15 28,378,363 (GRCm38) missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28,246,319 (GRCm38) missense probably benign 0.00
R0127:Dnah5 UTSW 15 28,294,925 (GRCm38) missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28,333,070 (GRCm38) missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28,299,110 (GRCm38) missense probably benign 0.19
R0386:Dnah5 UTSW 15 28,383,581 (GRCm38) missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28,229,541 (GRCm38) missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28,383,599 (GRCm38) missense probably benign 0.31
R0514:Dnah5 UTSW 15 28,366,321 (GRCm38) missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28,327,779 (GRCm38) missense probably benign
R0720:Dnah5 UTSW 15 28,313,861 (GRCm38) missense probably null 0.98
R0731:Dnah5 UTSW 15 28,311,143 (GRCm38) missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28,444,187 (GRCm38) missense possibly damaging 0.64
R0747:Dnah5 UTSW 15 28,444,186 (GRCm38) missense probably damaging 0.99
R0766:Dnah5 UTSW 15 28,448,487 (GRCm38) missense probably null 0.89
R0849:Dnah5 UTSW 15 28,263,599 (GRCm38) missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28,302,471 (GRCm38) missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28,343,452 (GRCm38) missense probably benign 0.01
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28,421,690 (GRCm38) missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28,246,257 (GRCm38) missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28,327,731 (GRCm38) missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28,313,918 (GRCm38) splice site probably benign
R1401:Dnah5 UTSW 15 28,401,913 (GRCm38) missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28,370,409 (GRCm38) missense probably benign
R1430:Dnah5 UTSW 15 28,345,857 (GRCm38) missense probably benign 0.37
R1457:Dnah5 UTSW 15 28,403,542 (GRCm38) critical splice donor site probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1468:Dnah5 UTSW 15 28,230,463 (GRCm38) nonsense probably null
R1560:Dnah5 UTSW 15 28,420,003 (GRCm38) missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1574:Dnah5 UTSW 15 28,252,423 (GRCm38) missense probably benign 0.00
R1603:Dnah5 UTSW 15 28,449,180 (GRCm38) missense probably benign 0.09
R1603:Dnah5 UTSW 15 28,294,985 (GRCm38) splice site probably benign
R1673:Dnah5 UTSW 15 28,290,148 (GRCm38) missense probably benign
R1755:Dnah5 UTSW 15 28,326,636 (GRCm38) missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28,313,786 (GRCm38) missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28,270,426 (GRCm38) missense probably benign 0.00
R1817:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1819:Dnah5 UTSW 15 28,246,400 (GRCm38) nonsense probably null
R1834:Dnah5 UTSW 15 28,409,124 (GRCm38) missense probably benign 0.00
R1855:Dnah5 UTSW 15 28,411,669 (GRCm38) missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1871:Dnah5 UTSW 15 28,331,713 (GRCm38) nonsense probably null
R1987:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28,343,591 (GRCm38) missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28,366,270 (GRCm38) missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28,312,388 (GRCm38) splice site probably null
R2121:Dnah5 UTSW 15 28,297,005 (GRCm38) splice site probably benign
R2128:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2129:Dnah5 UTSW 15 28,408,321 (GRCm38) missense probably benign 0.00
R2151:Dnah5 UTSW 15 28,444,091 (GRCm38) missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28,252,545 (GRCm38) missense probably benign 0.00
R2207:Dnah5 UTSW 15 28,343,671 (GRCm38) missense probably benign 0.11
R2231:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2232:Dnah5 UTSW 15 28,408,417 (GRCm38) critical splice donor site probably null
R2282:Dnah5 UTSW 15 28,327,302 (GRCm38) missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28,387,767 (GRCm38) missense probably benign 0.25
R2339:Dnah5 UTSW 15 28,313,882 (GRCm38) missense probably benign 0.00
R2437:Dnah5 UTSW 15 28,307,391 (GRCm38) critical splice donor site probably null
R2696:Dnah5 UTSW 15 28,278,576 (GRCm38) missense probably benign 0.00
R3156:Dnah5 UTSW 15 28,438,091 (GRCm38) splice site probably benign
R3431:Dnah5 UTSW 15 28,295,267 (GRCm38) missense probably benign 0.20
R3700:Dnah5 UTSW 15 28,387,791 (GRCm38) missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably benign 0.08
R3732:Dnah5 UTSW 15 28,409,122 (GRCm38) missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28,411,510 (GRCm38) missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28,420,998 (GRCm38) missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28,340,298 (GRCm38) nonsense probably null
R4075:Dnah5 UTSW 15 28,293,791 (GRCm38) missense probably benign
R4245:Dnah5 UTSW 15 28,219,189 (GRCm38) missense probably benign
R4254:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4255:Dnah5 UTSW 15 28,438,102 (GRCm38) missense probably benign 0.07
R4392:Dnah5 UTSW 15 28,289,229 (GRCm38) missense probably benign 0.19
R4552:Dnah5 UTSW 15 28,397,154 (GRCm38) missense probably benign 0.19
R4574:Dnah5 UTSW 15 28,367,763 (GRCm38) missense probably benign 0.05
R4577:Dnah5 UTSW 15 28,289,250 (GRCm38) missense probably benign 0.06
R4587:Dnah5 UTSW 15 28,304,599 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,419,994 (GRCm38) missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28,401,953 (GRCm38) missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28,295,260 (GRCm38) missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28,372,375 (GRCm38) missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28,420,955 (GRCm38) splice site probably null
R4767:Dnah5 UTSW 15 28,270,474 (GRCm38) missense probably benign 0.02
R4857:Dnah5 UTSW 15 28,345,807 (GRCm38) missense probably benign 0.00
R4883:Dnah5 UTSW 15 28,343,638 (GRCm38) missense probably benign 0.00
R4889:Dnah5 UTSW 15 28,235,792 (GRCm38) missense probably benign 0.01
R4946:Dnah5 UTSW 15 28,387,904 (GRCm38) missense probably damaging 1.00
R4946:Dnah5 UTSW 15 28,326,557 (GRCm38) missense probably damaging 0.96
R4947:Dnah5 UTSW 15 28,272,372 (GRCm38) missense probably benign
R5033:Dnah5 UTSW 15 28,421,678 (GRCm38) missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28,408,292 (GRCm38) missense probably benign 0.00
R5175:Dnah5 UTSW 15 28,448,404 (GRCm38) missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28,311,278 (GRCm38) missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28,272,172 (GRCm38) missense probably benign 0.41
R5272:Dnah5 UTSW 15 28,350,665 (GRCm38) missense probably benign
R5308:Dnah5 UTSW 15 28,229,651 (GRCm38) missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28,311,328 (GRCm38) missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28,384,244 (GRCm38) missense probably benign 0.41
R5398:Dnah5 UTSW 15 28,293,726 (GRCm38) missense probably benign
R5596:Dnah5 UTSW 15 28,343,608 (GRCm38) missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28,419,932 (GRCm38) missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28,302,435 (GRCm38) missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28,421,064 (GRCm38) missense probably benign 0.03
R5741:Dnah5 UTSW 15 28,246,367 (GRCm38) missense probably benign 0.11
R5754:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.01
R5763:Dnah5 UTSW 15 28,311,152 (GRCm38) missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28,313,821 (GRCm38) missense probably benign 0.00
R5836:Dnah5 UTSW 15 28,383,592 (GRCm38) missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28,290,195 (GRCm38) missense probably benign 0.00
R5864:Dnah5 UTSW 15 28,297,013 (GRCm38) missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28,234,453 (GRCm38) splice site probably null
R5896:Dnah5 UTSW 15 28,272,060 (GRCm38) missense probably benign
R5899:Dnah5 UTSW 15 28,448,367 (GRCm38) missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28,307,327 (GRCm38) missense probably benign 0.41
R5927:Dnah5 UTSW 15 28,335,718 (GRCm38) missense probably benign 0.00
R5929:Dnah5 UTSW 15 28,311,208 (GRCm38) missense probably damaging 1.00
R5929:Dnah5 UTSW 15 28,311,207 (GRCm38) missense probably benign 0.01
R5931:Dnah5 UTSW 15 28,453,279 (GRCm38) missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28,458,584 (GRCm38) missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28,234,282 (GRCm38) missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28,299,226 (GRCm38) missense probably benign 0.09
R6016:Dnah5 UTSW 15 28,327,884 (GRCm38) missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28,387,833 (GRCm38) missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28,230,468 (GRCm38) missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28,270,420 (GRCm38) missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28,233,231 (GRCm38) missense probably benign 0.05
R6146:Dnah5 UTSW 15 28,459,185 (GRCm38) missense probably benign
R6154:Dnah5 UTSW 15 28,204,031 (GRCm38) missense probably benign 0.15
R6164:Dnah5 UTSW 15 28,378,343 (GRCm38) missense probably benign 0.08
R6266:Dnah5 UTSW 15 28,335,627 (GRCm38) missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28,372,411 (GRCm38) missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28,238,511 (GRCm38) missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28,349,824 (GRCm38) missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28,438,183 (GRCm38) missense probably benign 0.10
R6564:Dnah5 UTSW 15 28,367,745 (GRCm38) missense probably benign
R6607:Dnah5 UTSW 15 28,445,200 (GRCm38) missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28,409,120 (GRCm38) missense probably benign 0.03
R6633:Dnah5 UTSW 15 28,293,787 (GRCm38) missense probably benign 0.27
R6647:Dnah5 UTSW 15 28,403,487 (GRCm38) missense probably benign 0.02
R6782:Dnah5 UTSW 15 28,449,156 (GRCm38) missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28,233,238 (GRCm38) nonsense probably null
R6797:Dnah5 UTSW 15 28,451,463 (GRCm38) missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28,411,515 (GRCm38) missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28,278,624 (GRCm38) missense probably benign 0.14
R6871:Dnah5 UTSW 15 28,229,640 (GRCm38) missense probably benign 0.32
R6936:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28,235,720 (GRCm38) missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28,333,062 (GRCm38) missense probably benign 0.00
R7030:Dnah5 UTSW 15 28,238,592 (GRCm38) missense probably benign
R7032:Dnah5 UTSW 15 28,326,650 (GRCm38) missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28,233,248 (GRCm38) missense probably benign 0.00
R7094:Dnah5 UTSW 15 28,453,336 (GRCm38) missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28,453,264 (GRCm38) missense probably benign 0.00
R7126:Dnah5 UTSW 15 28,349,837 (GRCm38) missense probably benign 0.03
R7153:Dnah5 UTSW 15 28,365,522 (GRCm38) splice site probably null
R7209:Dnah5 UTSW 15 28,459,225 (GRCm38) missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28,367,838 (GRCm38) missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28,270,470 (GRCm38) missense probably null 0.33
R7350:Dnah5 UTSW 15 28,235,819 (GRCm38) critical splice donor site probably null
R7380:Dnah5 UTSW 15 28,370,378 (GRCm38) missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28,302,450 (GRCm38) missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28,370,415 (GRCm38) missense probably benign
R7519:Dnah5 UTSW 15 28,390,483 (GRCm38) missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28,297,066 (GRCm38) missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28,290,243 (GRCm38) missense probably null 0.43
R7570:Dnah5 UTSW 15 28,346,952 (GRCm38) missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28,401,868 (GRCm38) missense probably benign 0.09
R7642:Dnah5 UTSW 15 28,247,979 (GRCm38) critical splice donor site probably null
R7670:Dnah5 UTSW 15 28,246,232 (GRCm38) splice site probably null
R7763:Dnah5 UTSW 15 28,313,855 (GRCm38) missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28,411,532 (GRCm38) missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28,367,812 (GRCm38) missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28,245,684 (GRCm38) missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28,448,414 (GRCm38) nonsense probably null
R7919:Dnah5 UTSW 15 28,350,596 (GRCm38) missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28,453,222 (GRCm38) missense probably benign 0.00
R7936:Dnah5 UTSW 15 28,345,837 (GRCm38) missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28,409,177 (GRCm38) missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28,230,583 (GRCm38) missense probably benign
R8084:Dnah5 UTSW 15 28,387,953 (GRCm38) missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28,372,402 (GRCm38) missense probably benign
R8114:Dnah5 UTSW 15 28,239,976 (GRCm38) missense probably benign 0.01
R8142:Dnah5 UTSW 15 28,384,373 (GRCm38) missense probably benign 0.36
R8153:Dnah5 UTSW 15 28,384,430 (GRCm38) missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28,350,704 (GRCm38) missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28,311,133 (GRCm38) splice site probably null
R8187:Dnah5 UTSW 15 28,384,209 (GRCm38) missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28,453,268 (GRCm38) missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28,408,392 (GRCm38) missense probably benign 0.01
R8291:Dnah5 UTSW 15 28,263,597 (GRCm38) missense probably benign 0.03
R8324:Dnah5 UTSW 15 28,346,865 (GRCm38) missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28,236,666 (GRCm38) missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28,444,167 (GRCm38) missense probably benign 0.03
R8356:Dnah5 UTSW 15 28,444,323 (GRCm38) missense probably null 0.02
R8361:Dnah5 UTSW 15 28,331,810 (GRCm38) missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28,327,343 (GRCm38) missense probably benign 0.00
R8474:Dnah5 UTSW 15 28,247,832 (GRCm38) missense probably benign 0.00
R8481:Dnah5 UTSW 15 28,419,795 (GRCm38) missense probably benign 0.00
R8494:Dnah5 UTSW 15 28,345,831 (GRCm38) missense probably benign 0.32
R8495:Dnah5 UTSW 15 28,409,268 (GRCm38) missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28,299,099 (GRCm38) missense probably benign 0.07
R8683:Dnah5 UTSW 15 28,289,221 (GRCm38) missense probably benign 0.00
R8739:Dnah5 UTSW 15 28,345,860 (GRCm38) missense probably benign 0.01
R8752:Dnah5 UTSW 15 28,290,219 (GRCm38) missense probably benign 0.00
R8784:Dnah5 UTSW 15 28,387,951 (GRCm38) missense probably benign 0.16
R8813:Dnah5 UTSW 15 28,229,573 (GRCm38) missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28,459,356 (GRCm38) splice site probably benign
R8873:Dnah5 UTSW 15 28,219,188 (GRCm38) missense probably benign
R8885:Dnah5 UTSW 15 28,327,740 (GRCm38) missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28,365,569 (GRCm38) missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28,409,266 (GRCm38) missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28,247,958 (GRCm38) missense probably benign 0.05
R9057:Dnah5 UTSW 15 28,390,868 (GRCm38) missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28,245,666 (GRCm38) missense probably benign
R9065:Dnah5 UTSW 15 28,293,790 (GRCm38) missense probably benign 0.09
R9098:Dnah5 UTSW 15 28,419,961 (GRCm38) missense
R9118:Dnah5 UTSW 15 28,401,848 (GRCm38) frame shift probably null
R9149:Dnah5 UTSW 15 28,387,768 (GRCm38) missense probably benign 0.00
R9184:Dnah5 UTSW 15 28,340,406 (GRCm38) missense probably benign 0.13
R9205:Dnah5 UTSW 15 28,448,334 (GRCm38) missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9302:Dnah5 UTSW 15 28,239,886 (GRCm38) missense probably benign 0.03
R9310:Dnah5 UTSW 15 28,448,433 (GRCm38) missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28,203,908 (GRCm38) start gained probably benign
R9405:Dnah5 UTSW 15 28,272,160 (GRCm38) missense probably benign
R9424:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9469:Dnah5 UTSW 15 28,421,000 (GRCm38) missense probably benign 0.06
R9548:Dnah5 UTSW 15 28,327,879 (GRCm38) missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28,290,276 (GRCm38) missense probably benign 0.04
R9576:Dnah5 UTSW 15 28,272,140 (GRCm38) missense probably benign 0.01
R9593:Dnah5 UTSW 15 28,236,628 (GRCm38) missense probably benign
R9644:Dnah5 UTSW 15 28,230,504 (GRCm38) missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28,242,754 (GRCm38) missense probably benign
R9657:Dnah5 UTSW 15 28,409,943 (GRCm38) missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28,247,819 (GRCm38) missense probably benign 0.00
R9797:Dnah5 UTSW 15 28,233,170 (GRCm38) missense probably benign 0.34
RF009:Dnah5 UTSW 15 28,204,019 (GRCm38) missense probably benign 0.00
X0011:Dnah5 UTSW 15 28,408,381 (GRCm38) missense probably benign 0.16
X0018:Dnah5 UTSW 15 28,269,354 (GRCm38) missense probably benign 0.00
X0022:Dnah5 UTSW 15 28,270,411 (GRCm38) missense probably benign 0.01
X0023:Dnah5 UTSW 15 28,384,308 (GRCm38) missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28,470,477 (GRCm38) missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28,366,357 (GRCm38) missense probably null 0.10
Z1088:Dnah5 UTSW 15 28,384,230 (GRCm38) missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28,295,311 (GRCm38) missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28,270,403 (GRCm38) missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28,270,354 (GRCm38) missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28,387,763 (GRCm38) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTCTGTTCTGTAGAAAAGCTTAAGG -3'
(R):5'- CCATGGAAGCATCTGAAGGC -3'

Sequencing Primer
(F):5'- AGACAGGTCTCTCTGAACCTG -3'
(R):5'- CATCTGAAGGCAAGGTACAGTTG -3'
Posted On 2022-06-15