Incidental Mutation 'R9467:Acap2'
ID 715238
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms Centb2, 9530039J15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9467 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 31092412-31201245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31111083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 361 (S361P)
Ref Sequence ENSEMBL: ENSMUSP00000061501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
AlphaFold Q6ZQK5
Predicted Effect possibly damaging
Transcript: ENSMUST00000058033
AA Change: S361P

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076
AA Change: S361P

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229010
AA Change: S379P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000230614
AA Change: S379P

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect possibly damaging
Transcript: ENSMUST00000231125
AA Change: S386P

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik C T 1: 105,741,314 T1023I probably damaging Het
4933409G03Rik A C 2: 68,593,590 M46L Het
Aars2 A G 17: 45,516,484 E484G probably benign Het
Abcd2 C T 15: 91,191,622 probably benign Het
Arap2 T C 5: 62,730,557 E482G probably benign Het
Axin2 G T 11: 108,942,956 L576F possibly damaging Het
B4galt2 T A 4: 117,880,926 Y161F probably damaging Het
Cbwd1 T A 19: 24,953,320 M122L possibly damaging Het
Cdh3 A T 8: 106,539,793 probably null Het
Cfap61 A T 2: 146,129,229 I920F probably benign Het
Chaf1b T C 16: 93,884,506 I4T probably benign Het
Clptm1 T C 7: 19,637,524 N328S probably benign Het
Cthrc1 A G 15: 39,084,294 N136S probably benign Het
Dlec1 G T 9: 119,142,584 R1279L probably damaging Het
Dnah5 A T 15: 28,366,147 T2669S possibly damaging Het
Efcab14 C A 4: 115,753,011 L190I probably damaging Het
Eml6 A T 11: 29,819,076 C690S probably damaging Het
Fignl1 T C 11: 11,801,483 E524G probably damaging Het
Fmo4 A G 1: 162,803,669 V243A probably benign Het
Ghr A G 15: 3,328,024 V254A probably benign Het
Gm21818 C T 13: 120,172,525 probably benign Het
Gm9008 C T 6: 76,496,632 E334K probably benign Het
Igkv8-28 A G 6: 70,143,707 V84A probably damaging Het
Itgb7 T C 15: 102,223,554 D198G probably damaging Het
Klra2 A G 6: 131,220,107 probably null Het
Klrc2 A T 6: 129,656,400 Y230N probably damaging Het
Lacc1 A G 14: 77,029,584 V413A probably damaging Het
Muc16 T C 9: 18,597,035 N6355S probably benign Het
Ncor1 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTGCTG 11: 62,433,611 probably benign Het
Ncor1 CTG CTGGTG 11: 62,433,622 probably benign Het
Ndn A G 7: 62,349,155 K250E possibly damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nt5e A G 9: 88,367,363 E450G probably benign Het
Olfr1008 G T 2: 85,690,282 M284I Het
Olfr1428 A T 19: 12,108,949 M199K possibly damaging Het
Olfr501-ps1 T A 7: 108,508,583 *176K probably null Het
Palld A G 8: 61,515,230 S1343P unknown Het
Pcdha8 T A 18: 36,993,790 S442T possibly damaging Het
Pole2 T C 12: 69,208,945 I349V probably benign Het
Ptprb C T 10: 116,322,485 T487M probably benign Het
Ptprc C T 1: 138,066,222 D1020N probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Ryr2 T C 13: 11,556,604 N4916S possibly damaging Het
Selp C T 1: 164,130,105 P268S probably damaging Het
Sema7a T A 9: 57,957,325 C333S probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 CAGCCACGGGGACCAGCT CAGCCACGGGGACCAGCTAAGCCACGGGGACCAGCT 7: 126,467,582 probably null Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Shisa5 G A 9: 109,038,644 probably benign Het
Snx27 A G 3: 94,582,416 V45A possibly damaging Het
Srcap T C 7: 127,540,359 V1284A probably damaging Het
Ssrp1 A G 2: 85,042,266 D416G probably damaging Het
Tectb A G 19: 55,192,661 Y144C Het
Thap12 G T 7: 98,710,141 V76F probably damaging Het
Ticam2 G C 18: 46,560,681 P113R probably damaging Het
Tsg101 A G 7: 46,909,024 Y80H probably benign Het
Unc5cl T A 17: 48,463,628 M368K probably damaging Het
Utp20 G T 10: 88,804,528 Q717K possibly damaging Het
Vmn1r159 T A 7: 22,842,716 D297V possibly damaging Het
Vmn2r98 G T 17: 19,067,255 S450I probably benign Het
Zbtb8b T C 4: 129,432,526 E282G probably benign Het
Zfp831 T C 2: 174,644,996 V488A probably benign Het
Zzef1 G A 11: 72,916,425 V2710I probably damaging Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7262:Acap2 UTSW 16 31127319 critical splice donor site probably null
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R8256:Acap2 UTSW 16 31139469 critical splice donor site probably null
R9026:Acap2 UTSW 16 31107088 missense probably damaging 0.99
R9177:Acap2 UTSW 16 31136574 missense probably damaging 1.00
R9252:Acap2 UTSW 16 31101823 critical splice donor site probably null
R9268:Acap2 UTSW 16 31136574 missense probably damaging 1.00
R9329:Acap2 UTSW 16 31127420 missense probably damaging 1.00
R9528:Acap2 UTSW 16 31111090 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCACAAGGTAATGCCCAGG -3'
(R):5'- CATCAATCGAATTGTAAGTGTGTGC -3'

Sequencing Primer
(F):5'- CAAGGTAATGCCCAGGTTGATGC -3'
(R):5'- GTTCATAAAAACCTCAGTGTCTCCCG -3'
Posted On 2022-06-15