Incidental Mutation 'R9468:Vmn1r158'
ID 715272
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Name vomeronasal 1 receptor 158
Synonyms Gm16455
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock # R9468 (G1)
Quality Score 167.009
Status Not validated
Chromosome 7
Chromosomal Location 22789859-22790782 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22790463 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 107 (T107N)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
AlphaFold G3UY92
Predicted Effect probably damaging
Transcript: ENSMUST00000174643
AA Change: T107N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: T107N

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,957,167 N68Y probably damaging Het
Acsf3 A T 8: 122,813,030 I466F probably damaging Het
Akr1b7 T C 6: 34,415,381 I43T probably benign Het
Alyref T A 11: 120,595,964 D157V probably damaging Het
Anapc2 T C 2: 25,273,120 L123P possibly damaging Het
Catsperg2 A T 7: 29,710,007 probably null Het
Ccz1 G T 5: 143,992,620 T330K probably benign Het
Chordc1 T A 9: 18,302,129 F92Y probably benign Het
Cyp2c29 A T 19: 39,307,722 D199V probably benign Het
Cyp2c70 A G 19: 40,180,445 S133P probably damaging Het
Dync1li2 G A 8: 104,420,626 P479S probably benign Het
Fcmr G T 1: 130,874,214 K68N possibly damaging Het
Frmpd2 T A 14: 33,544,475 D949E possibly damaging Het
Fscn2 A G 11: 120,362,457 E250G probably damaging Het
Grk2 A T 19: 4,294,924 I39N probably damaging Het
Hmmr T A 11: 40,723,487 R125* probably null Het
Jarid2 T A 13: 44,919,830 C1195S probably damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif24 A T 4: 41,404,794 I402N probably damaging Het
Kmt2b A G 7: 30,585,088 V793A probably damaging Het
Kntc1 T C 5: 123,816,713 Y2065H probably damaging Het
Krt5 C A 15: 101,707,545 S545I unknown Het
Larp1b A T 3: 40,976,555 I290L probably benign Het
Lnx2 C T 5: 147,042,479 probably benign Het
Lonrf2 A G 1: 38,800,758 S419P probably damaging Het
Lrrc19 A T 4: 94,638,284 D345E probably benign Het
Micu3 T A 8: 40,354,381 L251* probably null Het
Mucl1 G T 15: 103,753,769 T57N possibly damaging Het
Myh8 C T 11: 67,306,904 R1866W probably damaging Het
Ndc80 G A 17: 71,499,311 Q583* probably null Het
Nrap G A 19: 56,342,200 T1143I possibly damaging Het
Nrde2 A G 12: 100,140,009 V523A probably benign Het
Olfr1121 T A 2: 87,371,772 V80E probably damaging Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr495 C T 7: 108,395,642 P174L possibly damaging Het
Olfr520 A T 7: 99,735,973 I277F possibly damaging Het
Pcdhb16 T A 18: 37,478,429 S147R probably damaging Het
Phf21b T C 15: 84,805,098 T76A probably damaging Het
Pknox2 A G 9: 36,911,199 V218A probably benign Het
Plekhg3 C T 12: 76,560,235 T23I probably damaging Het
Ptprb A G 10: 116,277,369 T85A probably benign Het
Ptprc A G 1: 138,117,016 L36P probably benign Het
Rasgrf1 A G 9: 89,998,703 Q834R probably benign Het
Rnft1 G A 11: 86,490,416 V211I probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Ryr1 G A 7: 29,073,085 L2468F probably damaging Het
Scaf4 C T 16: 90,229,399 A1177T unknown Het
Sec14l3 A G 11: 4,075,200 Y270C probably damaging Het
Serpind1 A T 16: 17,336,315 K2I possibly damaging Het
Slc6a20b A G 9: 123,610,351 S138P probably damaging Het
Son T A 16: 91,657,551 M1062K possibly damaging Het
Sorl1 T C 9: 42,124,088 E9G probably benign Het
Stx16 T C 2: 174,091,534 L102P probably damaging Het
Syt12 A T 19: 4,447,716 S413T probably damaging Het
Tex37 T C 6: 70,913,643 Q55R probably benign Het
Tie1 A G 4: 118,476,179 L830P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tnfrsf19 A G 14: 61,024,174 S59P possibly damaging Het
Tpk1 T C 6: 43,559,967 D54G probably benign Het
Trim39 G T 17: 36,260,600 T422K probably benign Het
Ttn T G 2: 76,705,768 E35082A Het
Vac14 T A 8: 110,671,106 D484E probably benign Het
Vmn1r51 T A 6: 90,129,948 I282N probably damaging Het
Vps26a A T 10: 62,464,737 Y217N probably damaging Het
Zfp942 G A 17: 21,929,441 T69I probably benign Het
Zmym4 A G 4: 126,907,200 S536P probably benign Het
Znrf3 A G 11: 5,338,696 V24A probably damaging Het
Zranb3 A G 1: 127,963,759 probably null Het
Zzef1 T C 11: 72,923,183 probably null Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22790214 missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6500:Vmn1r158 UTSW 7 22790653 missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22790040 missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22790008 missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22790062 missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22789880 nonsense probably null
R8809:Vmn1r158 UTSW 7 22790350 missense probably damaging 0.97
R9227:Vmn1r158 UTSW 7 22790044 missense probably benign 0.02
Z1177:Vmn1r158 UTSW 7 22790458 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGACCACTGACCTTAATTGG -3'
(R):5'- GAACTGTGGCCAAAGTCTTTCTG -3'

Sequencing Primer
(F):5'- GGACCACTGACCTTAATTGGAATGTG -3'
(R):5'- CTTGACTGGTTCTAAACAGAGGCC -3'
Posted On 2022-06-15