Incidental Mutation 'R9469:Tcaf3'
ID 715346
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42573828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 128 (I128T)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: I128T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I128T

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
AA Change: I128T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: I128T

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 A T 17: 57,183,283 (GRCm39) D8V probably benign Het
Ada T A 2: 163,574,192 (GRCm39) M155L probably benign Het
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Ahnak G A 19: 8,988,225 (GRCm39) G3170R probably damaging Het
Alb G A 5: 90,610,659 (GRCm39) D80N probably benign Het
Amph G T 13: 19,270,769 (GRCm39) G126V probably damaging Het
Anks1b A T 10: 90,733,205 (GRCm39) M994L possibly damaging Het
Atp8a2 A G 14: 60,028,668 (GRCm39) L933P probably benign Het
Bcas1 T C 2: 170,191,292 (GRCm39) D546G possibly damaging Het
Bmpr2 A C 1: 59,881,928 (GRCm39) M186L probably benign Het
Clca3a2 T C 3: 144,507,938 (GRCm39) I711V probably damaging Het
Cobll1 G A 2: 64,966,774 (GRCm39) T128I probably damaging Het
Cog4 T C 8: 111,608,804 (GRCm39) W165R unknown Het
Cyp2j5 G A 4: 96,517,731 (GRCm39) R494* probably null Het
Dnah2 G A 11: 69,321,896 (GRCm39) A3808V probably damaging Het
Dnah5 A T 15: 28,421,146 (GRCm39) T3828S probably benign Het
Dsg1c T C 18: 20,400,947 (GRCm39) I150T probably damaging Het
Ehd2 A T 7: 15,684,332 (GRCm39) I489N probably damaging Het
Fam24a C A 7: 130,938,392 (GRCm39) T94K probably damaging Het
Gata2 A G 6: 88,182,301 (GRCm39) E423G possibly damaging Het
Gm8947 A G 1: 151,069,063 (GRCm39) I299V unknown Het
Gpr161 A G 1: 165,133,896 (GRCm39) I53V possibly damaging Het
Guca2b G A 4: 119,515,817 (GRCm39) Q15* probably null Het
Hus1 A G 11: 8,948,744 (GRCm39) V219A probably benign Het
Il5 T C 11: 53,614,824 (GRCm39) W129R probably damaging Het
Ipmk A G 10: 71,201,843 (GRCm39) Y77C probably damaging Het
Kcnip3 A G 2: 127,307,322 (GRCm39) L136P probably benign Het
Klhl2 G A 8: 65,196,069 (GRCm39) A558V probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lig3 G A 11: 82,686,199 (GRCm39) C613Y probably benign Het
Lrriq1 A G 10: 103,050,761 (GRCm39) S664P probably benign Het
Megf6 A G 4: 154,335,369 (GRCm39) Y276C probably damaging Het
Mlph A G 1: 90,856,068 (GRCm39) E119G probably damaging Het
Mrpl39 T G 16: 84,517,170 (GRCm39) R316S probably damaging Het
Myo18b T C 5: 112,994,247 (GRCm39) D902G probably benign Het
Myocd A G 11: 65,087,220 (GRCm39) S236P probably benign Het
Myom1 G T 17: 71,368,122 (GRCm39) A482S possibly damaging Het
Nol4 A G 18: 23,085,318 (GRCm39) V32A probably damaging Het
Nrp2 T C 1: 62,804,030 (GRCm39) Y555H probably damaging Het
Or12d12 T C 17: 37,610,956 (GRCm39) D119G probably damaging Het
Or4d10c G A 19: 12,065,434 (GRCm39) H241Y probably benign Het
Or52l1 A T 7: 104,829,967 (GRCm39) H199Q probably damaging Het
Or8k27 C A 2: 86,275,787 (GRCm39) D180Y probably damaging Het
Papss1 A G 3: 131,288,959 (GRCm39) K175E possibly damaging Het
Pdcd5 T C 7: 35,343,827 (GRCm39) M39V probably benign Het
Plcl2 G A 17: 50,913,953 (GRCm39) D321N probably benign Het
Plxna4 G A 6: 32,494,526 (GRCm39) P30L probably benign Het
Pou2f1 G A 1: 165,740,830 (GRCm39) T113I probably benign Het
Ptpn2 T A 18: 67,808,907 (GRCm39) H303L probably benign Het
R3hdm1 T A 1: 128,106,921 (GRCm39) probably null Het
Rdx T C 9: 51,977,069 (GRCm39) V106A probably damaging Het
Ripk2 T C 4: 16,138,181 (GRCm39) D249G possibly damaging Het
Rnf169 A T 7: 99,575,567 (GRCm39) S343T possibly damaging Het
Rnf40 T A 7: 127,195,769 (GRCm39) L671Q probably damaging Het
Scube3 C A 17: 28,386,138 (GRCm39) S793* probably null Het
Sipa1l3 A T 7: 29,028,481 (GRCm39) M1633K possibly damaging Het
Slc16a14 A T 1: 84,900,612 (GRCm39) N124K probably benign Het
Smarcd2 G A 11: 106,163,332 (GRCm39) A68V probably benign Het
Smg1 T C 7: 117,739,774 (GRCm39) E3391G possibly damaging Het
Spata32 T C 11: 103,099,741 (GRCm39) M255V possibly damaging Het
Sstr5 T A 17: 25,710,941 (GRCm39) Q96L probably damaging Het
Tfdp1 C T 8: 13,422,965 (GRCm39) T290M probably benign Het
Ticrr C T 7: 79,344,511 (GRCm39) H1459Y probably benign Het
Tmed4 T A 11: 6,223,763 (GRCm39) Q171L probably benign Het
Tmem40 G A 6: 115,719,321 (GRCm39) S48F possibly damaging Het
Tnfaip1 A G 11: 78,419,075 (GRCm39) probably null Het
Top1mt A G 15: 75,539,742 (GRCm39) Y290H probably damaging Het
Topaz1 A T 9: 122,577,585 (GRCm39) D165V probably damaging Het
Trim44 T C 2: 102,230,651 (GRCm39) S127G unknown Het
Ubac1 G A 2: 25,897,763 (GRCm39) R286C probably damaging Het
Ube2u A G 4: 100,406,958 (GRCm39) E273G possibly damaging Het
Vmn1r213 G A 13: 23,196,101 (GRCm39) S228N probably benign Het
Vmn2r28 A T 7: 5,487,118 (GRCm39) V515E probably damaging Het
Vps13d A G 4: 144,780,691 (GRCm39) L4011P Het
Ythdc2 T C 18: 45,019,383 (GRCm39) F1384S probably damaging Het
Zfp423 T A 8: 88,509,519 (GRCm39) Y275F probably damaging Het
Zfp493 A G 13: 67,934,325 (GRCm39) K93E probably benign Het
Zfp980 G T 4: 145,427,687 (GRCm39) G139W probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACCAGTCTCTATTCGCAG -3'
(R):5'- TCGTATCCCATGAGAGCTACC -3'

Sequencing Primer
(F):5'- TCTCTATTCGCAGAGATATCAGTG -3'
(R):5'- TACCTGCTGCACGATGGC -3'
Posted On 2022-06-15