Incidental Mutation 'R9469:Tcaf3'
ID 715346
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42596894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 128 (I128T)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: I128T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: I128T

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
AA Change: I128T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: I128T

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,283 D8V probably benign Het
Ada T A 2: 163,732,272 M155L probably benign Het
Adam23 A G 1: 63,545,512 I360V probably benign Het
Ahnak G A 19: 9,010,861 G3170R probably damaging Het
Alb G A 5: 90,462,800 D80N probably benign Het
Amph G T 13: 19,086,599 G126V probably damaging Het
Anks1b A T 10: 90,897,343 M994L possibly damaging Het
Atp8a2 A G 14: 59,791,219 L933P probably benign Het
Bcas1 T C 2: 170,349,372 D546G possibly damaging Het
Bmpr2 A C 1: 59,842,769 M186L probably benign Het
Clca3a2 T C 3: 144,802,177 I711V probably damaging Het
Cobll1 G A 2: 65,136,430 T128I probably damaging Het
Cog4 T C 8: 110,882,172 W165R unknown Het
Cyp2j5 G A 4: 96,629,494 R494* probably null Het
Dnah2 G A 11: 69,431,070 A3808V probably damaging Het
Dnah5 A T 15: 28,421,000 T3828S probably benign Het
Dsg1c T C 18: 20,267,890 I150T probably damaging Het
Ehd2 A T 7: 15,950,407 I489N probably damaging Het
Fam24a C A 7: 131,336,663 T94K probably damaging Het
Gata2 A G 6: 88,205,319 E423G possibly damaging Het
Gm8947 A G 1: 151,193,312 I299V unknown Het
Gpr161 A G 1: 165,306,327 I53V possibly damaging Het
Guca2b G A 4: 119,658,620 Q15* probably null Het
Hus1 A G 11: 8,998,744 V219A probably benign Het
Il5 T C 11: 53,723,997 W129R probably damaging Het
Ipmk A G 10: 71,366,013 Y77C probably damaging Het
Kcnip3 A G 2: 127,465,402 L136P probably benign Het
Klhl2 G A 8: 64,743,035 A558V probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lig3 G A 11: 82,795,373 C613Y probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Megf6 A G 4: 154,250,912 Y276C probably damaging Het
Mlph A G 1: 90,928,346 E119G probably damaging Het
Mrpl39 T G 16: 84,720,282 R316S probably damaging Het
Myo18b T C 5: 112,846,381 D902G probably benign Het
Myocd A G 11: 65,196,394 S236P probably benign Het
Myom1 G T 17: 71,061,127 A482S possibly damaging Het
Nol4 A G 18: 22,952,261 V32A probably damaging Het
Nrp2 T C 1: 62,764,871 Y555H probably damaging Het
Olfr101 T C 17: 37,300,065 D119G probably damaging Het
Olfr1065 C A 2: 86,445,443 D180Y probably damaging Het
Olfr1426 G A 19: 12,088,070 H241Y probably benign Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Papss1 A G 3: 131,583,198 K175E possibly damaging Het
Pdcd5 T C 7: 35,644,402 M39V probably benign Het
Plcl2 G A 17: 50,606,925 D321N probably benign Het
Plxna4 G A 6: 32,517,591 P30L probably benign Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ptpn2 T A 18: 67,675,837 H303L probably benign Het
R3hdm1 T A 1: 128,179,184 probably null Het
Rdx T C 9: 52,065,769 V106A probably damaging Het
Ripk2 T C 4: 16,138,181 D249G possibly damaging Het
Rnf169 A T 7: 99,926,360 S343T possibly damaging Het
Rnf40 T A 7: 127,596,597 L671Q probably damaging Het
Scube3 C A 17: 28,167,164 S793* probably null Het
Sipa1l3 A T 7: 29,329,056 M1633K possibly damaging Het
Slc16a14 A T 1: 84,922,891 N124K probably benign Het
Smarcd2 G A 11: 106,272,506 A68V probably benign Het
Smg1 T C 7: 118,140,551 E3391G possibly damaging Het
Spata32 T C 11: 103,208,915 M255V possibly damaging Het
Sstr5 T A 17: 25,491,967 Q96L probably damaging Het
Tfdp1 C T 8: 13,372,965 T290M probably benign Het
Ticrr C T 7: 79,694,763 H1459Y probably benign Het
Tmed4 T A 11: 6,273,763 Q171L probably benign Het
Tmem40 G A 6: 115,742,360 S48F possibly damaging Het
Tnfaip1 A G 11: 78,528,249 probably null Het
Top1mt A G 15: 75,667,893 Y290H probably damaging Het
Topaz1 A T 9: 122,748,520 D165V probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ubac1 G A 2: 26,007,751 R286C probably damaging Het
Ube2u A G 4: 100,549,761 E273G possibly damaging Het
Vmn1r213 G A 13: 23,011,931 S228N probably benign Het
Vmn2r28 A T 7: 5,484,119 V515E probably damaging Het
Vps13d A G 4: 145,054,121 L4011P Het
Ythdc2 T C 18: 44,886,316 F1384S probably damaging Het
Zfp423 T A 8: 87,782,891 Y275F probably damaging Het
Zfp493 A G 13: 67,786,206 K93E probably benign Het
Zfp980 G T 4: 145,701,117 G139W probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACCAGTCTCTATTCGCAG -3'
(R):5'- TCGTATCCCATGAGAGCTACC -3'

Sequencing Primer
(F):5'- TCTCTATTCGCAGAGATATCAGTG -3'
(R):5'- TACCTGCTGCACGATGGC -3'
Posted On 2022-06-15