Incidental Mutation 'R9469:Ticrr'
ID 715354
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79694763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1459 (H1459Y)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably benign
Transcript: ENSMUST00000035977
AA Change: H1459Y

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: H1459Y

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,283 D8V probably benign Het
Ada T A 2: 163,732,272 M155L probably benign Het
Adam23 A G 1: 63,545,512 I360V probably benign Het
Ahnak G A 19: 9,010,861 G3170R probably damaging Het
Alb G A 5: 90,462,800 D80N probably benign Het
Amph G T 13: 19,086,599 G126V probably damaging Het
Anks1b A T 10: 90,897,343 M994L possibly damaging Het
Atp8a2 A G 14: 59,791,219 L933P probably benign Het
Bcas1 T C 2: 170,349,372 D546G possibly damaging Het
Bmpr2 A C 1: 59,842,769 M186L probably benign Het
Clca3a2 T C 3: 144,802,177 I711V probably damaging Het
Cobll1 G A 2: 65,136,430 T128I probably damaging Het
Cog4 T C 8: 110,882,172 W165R unknown Het
Cyp2j5 G A 4: 96,629,494 R494* probably null Het
Dnah2 G A 11: 69,431,070 A3808V probably damaging Het
Dnah5 A T 15: 28,421,000 T3828S probably benign Het
Dsg1c T C 18: 20,267,890 I150T probably damaging Het
Ehd2 A T 7: 15,950,407 I489N probably damaging Het
Fam24a C A 7: 131,336,663 T94K probably damaging Het
Gata2 A G 6: 88,205,319 E423G possibly damaging Het
Gm8947 A G 1: 151,193,312 I299V unknown Het
Gpr161 A G 1: 165,306,327 I53V possibly damaging Het
Guca2b G A 4: 119,658,620 Q15* probably null Het
Hus1 A G 11: 8,998,744 V219A probably benign Het
Il5 T C 11: 53,723,997 W129R probably damaging Het
Ipmk A G 10: 71,366,013 Y77C probably damaging Het
Kcnip3 A G 2: 127,465,402 L136P probably benign Het
Klhl2 G A 8: 64,743,035 A558V probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lig3 G A 11: 82,795,373 C613Y probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Megf6 A G 4: 154,250,912 Y276C probably damaging Het
Mlph A G 1: 90,928,346 E119G probably damaging Het
Mrpl39 T G 16: 84,720,282 R316S probably damaging Het
Myo18b T C 5: 112,846,381 D902G probably benign Het
Myocd A G 11: 65,196,394 S236P probably benign Het
Myom1 G T 17: 71,061,127 A482S possibly damaging Het
Nol4 A G 18: 22,952,261 V32A probably damaging Het
Nrp2 T C 1: 62,764,871 Y555H probably damaging Het
Olfr101 T C 17: 37,300,065 D119G probably damaging Het
Olfr1065 C A 2: 86,445,443 D180Y probably damaging Het
Olfr1426 G A 19: 12,088,070 H241Y probably benign Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Papss1 A G 3: 131,583,198 K175E possibly damaging Het
Pdcd5 T C 7: 35,644,402 M39V probably benign Het
Plcl2 G A 17: 50,606,925 D321N probably benign Het
Plxna4 G A 6: 32,517,591 P30L probably benign Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ptpn2 T A 18: 67,675,837 H303L probably benign Het
R3hdm1 T A 1: 128,179,184 probably null Het
Rdx T C 9: 52,065,769 V106A probably damaging Het
Ripk2 T C 4: 16,138,181 D249G possibly damaging Het
Rnf169 A T 7: 99,926,360 S343T possibly damaging Het
Rnf40 T A 7: 127,596,597 L671Q probably damaging Het
Scube3 C A 17: 28,167,164 S793* probably null Het
Sipa1l3 A T 7: 29,329,056 M1633K possibly damaging Het
Slc16a14 A T 1: 84,922,891 N124K probably benign Het
Smarcd2 G A 11: 106,272,506 A68V probably benign Het
Smg1 T C 7: 118,140,551 E3391G possibly damaging Het
Spata32 T C 11: 103,208,915 M255V possibly damaging Het
Sstr5 T A 17: 25,491,967 Q96L probably damaging Het
Tcaf3 A G 6: 42,596,894 I128T probably benign Het
Tfdp1 C T 8: 13,372,965 T290M probably benign Het
Tmed4 T A 11: 6,273,763 Q171L probably benign Het
Tmem40 G A 6: 115,742,360 S48F possibly damaging Het
Tnfaip1 A G 11: 78,528,249 probably null Het
Top1mt A G 15: 75,667,893 Y290H probably damaging Het
Topaz1 A T 9: 122,748,520 D165V probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ubac1 G A 2: 26,007,751 R286C probably damaging Het
Ube2u A G 4: 100,549,761 E273G possibly damaging Het
Vmn1r213 G A 13: 23,011,931 S228N probably benign Het
Vmn2r28 A T 7: 5,484,119 V515E probably damaging Het
Vps13d A G 4: 145,054,121 L4011P Het
Ythdc2 T C 18: 44,886,316 F1384S probably damaging Het
Zfp423 T A 8: 87,782,891 Y275F probably damaging Het
Zfp493 A G 13: 67,786,206 K93E probably benign Het
Zfp980 G T 4: 145,701,117 G139W probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79680987 missense probably damaging 0.99
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
R9779:Ticrr UTSW 7 79679054 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAAGAAGTCCTGTCCTCCTCAG -3'
(R):5'- TGAGCAGCATCTTGCCTCTG -3'

Sequencing Primer
(F):5'- TCCTCAGGACTTCCCAGAGTG -3'
(R):5'- GCAGCATCTTGCCTCTGCTTTC -3'
Posted On 2022-06-15