Incidental Mutation 'R9469:Smg1'
ID 715357
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms 2610207I05Rik, 5430435M13Rik, C130002K18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 118131308-118243670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118140551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3391 (E3391G)
Ref Sequence ENSEMBL: ENSMUSP00000032891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032891
AA Change: E3391G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: E3391G

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178025
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,283 D8V probably benign Het
Ada T A 2: 163,732,272 M155L probably benign Het
Adam23 A G 1: 63,545,512 I360V probably benign Het
Ahnak G A 19: 9,010,861 G3170R probably damaging Het
Alb G A 5: 90,462,800 D80N probably benign Het
Amph G T 13: 19,086,599 G126V probably damaging Het
Anks1b A T 10: 90,897,343 M994L possibly damaging Het
Atp8a2 A G 14: 59,791,219 L933P probably benign Het
Bcas1 T C 2: 170,349,372 D546G possibly damaging Het
Bmpr2 A C 1: 59,842,769 M186L probably benign Het
Clca3a2 T C 3: 144,802,177 I711V probably damaging Het
Cobll1 G A 2: 65,136,430 T128I probably damaging Het
Cog4 T C 8: 110,882,172 W165R unknown Het
Cyp2j5 G A 4: 96,629,494 R494* probably null Het
Dnah2 G A 11: 69,431,070 A3808V probably damaging Het
Dnah5 A T 15: 28,421,000 T3828S probably benign Het
Dsg1c T C 18: 20,267,890 I150T probably damaging Het
Ehd2 A T 7: 15,950,407 I489N probably damaging Het
Fam24a C A 7: 131,336,663 T94K probably damaging Het
Gata2 A G 6: 88,205,319 E423G possibly damaging Het
Gm8947 A G 1: 151,193,312 I299V unknown Het
Gpr161 A G 1: 165,306,327 I53V possibly damaging Het
Guca2b G A 4: 119,658,620 Q15* probably null Het
Hus1 A G 11: 8,998,744 V219A probably benign Het
Il5 T C 11: 53,723,997 W129R probably damaging Het
Ipmk A G 10: 71,366,013 Y77C probably damaging Het
Kcnip3 A G 2: 127,465,402 L136P probably benign Het
Klhl2 G A 8: 64,743,035 A558V probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lig3 G A 11: 82,795,373 C613Y probably benign Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Megf6 A G 4: 154,250,912 Y276C probably damaging Het
Mlph A G 1: 90,928,346 E119G probably damaging Het
Mrpl39 T G 16: 84,720,282 R316S probably damaging Het
Myo18b T C 5: 112,846,381 D902G probably benign Het
Myocd A G 11: 65,196,394 S236P probably benign Het
Myom1 G T 17: 71,061,127 A482S possibly damaging Het
Nol4 A G 18: 22,952,261 V32A probably damaging Het
Nrp2 T C 1: 62,764,871 Y555H probably damaging Het
Olfr101 T C 17: 37,300,065 D119G probably damaging Het
Olfr1065 C A 2: 86,445,443 D180Y probably damaging Het
Olfr1426 G A 19: 12,088,070 H241Y probably benign Het
Olfr685 A T 7: 105,180,760 H199Q probably damaging Het
Papss1 A G 3: 131,583,198 K175E possibly damaging Het
Pdcd5 T C 7: 35,644,402 M39V probably benign Het
Plcl2 G A 17: 50,606,925 D321N probably benign Het
Plxna4 G A 6: 32,517,591 P30L probably benign Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ptpn2 T A 18: 67,675,837 H303L probably benign Het
R3hdm1 T A 1: 128,179,184 probably null Het
Rdx T C 9: 52,065,769 V106A probably damaging Het
Ripk2 T C 4: 16,138,181 D249G possibly damaging Het
Rnf169 A T 7: 99,926,360 S343T possibly damaging Het
Rnf40 T A 7: 127,596,597 L671Q probably damaging Het
Scube3 C A 17: 28,167,164 S793* probably null Het
Sipa1l3 A T 7: 29,329,056 M1633K possibly damaging Het
Slc16a14 A T 1: 84,922,891 N124K probably benign Het
Smarcd2 G A 11: 106,272,506 A68V probably benign Het
Spata32 T C 11: 103,208,915 M255V possibly damaging Het
Sstr5 T A 17: 25,491,967 Q96L probably damaging Het
Tcaf3 A G 6: 42,596,894 I128T probably benign Het
Tfdp1 C T 8: 13,372,965 T290M probably benign Het
Ticrr C T 7: 79,694,763 H1459Y probably benign Het
Tmed4 T A 11: 6,273,763 Q171L probably benign Het
Tmem40 G A 6: 115,742,360 S48F possibly damaging Het
Tnfaip1 A G 11: 78,528,249 probably null Het
Top1mt A G 15: 75,667,893 Y290H probably damaging Het
Topaz1 A T 9: 122,748,520 D165V probably damaging Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Ubac1 G A 2: 26,007,751 R286C probably damaging Het
Ube2u A G 4: 100,549,761 E273G possibly damaging Het
Vmn1r213 G A 13: 23,011,931 S228N probably benign Het
Vmn2r28 A T 7: 5,484,119 V515E probably damaging Het
Vps13d A G 4: 145,054,121 L4011P Het
Ythdc2 T C 18: 44,886,316 F1384S probably damaging Het
Zfp423 T A 8: 87,782,891 Y275F probably damaging Het
Zfp493 A G 13: 67,786,206 K93E probably benign Het
Zfp980 G T 4: 145,701,117 G139W probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
R7798:Smg1 UTSW 7 118171939 missense possibly damaging 0.73
R7908:Smg1 UTSW 7 118186134 missense unknown
R7923:Smg1 UTSW 7 118143322 missense possibly damaging 0.96
R7978:Smg1 UTSW 7 118193655 missense unknown
R7997:Smg1 UTSW 7 118173141 missense unknown
R7997:Smg1 UTSW 7 118173142 missense unknown
R8025:Smg1 UTSW 7 118206989 nonsense probably null
R8056:Smg1 UTSW 7 118160366 missense unknown
R8061:Smg1 UTSW 7 118152387 missense unknown
R8095:Smg1 UTSW 7 118173062 missense unknown
R8198:Smg1 UTSW 7 118145606 missense probably benign 0.03
R8399:Smg1 UTSW 7 118190571 missense unknown
R8445:Smg1 UTSW 7 118136977 missense possibly damaging 0.72
R8519:Smg1 UTSW 7 118171759 utr 3 prime probably benign
R8817:Smg1 UTSW 7 118159664 missense unknown
R8832:Smg1 UTSW 7 118139783 missense probably benign 0.33
R8855:Smg1 UTSW 7 118206899 missense unknown
R8866:Smg1 UTSW 7 118206899 missense unknown
R8946:Smg1 UTSW 7 118152677 missense probably null
R8954:Smg1 UTSW 7 118206992 missense probably damaging 1.00
R8967:Smg1 UTSW 7 118166516 missense unknown
R9072:Smg1 UTSW 7 118183809 missense unknown
R9090:Smg1 UTSW 7 118212563 missense unknown
R9156:Smg1 UTSW 7 118154661 missense unknown
R9198:Smg1 UTSW 7 118195956 missense unknown
R9240:Smg1 UTSW 7 118139808 missense probably benign 0.18
R9271:Smg1 UTSW 7 118212563 missense unknown
R9289:Smg1 UTSW 7 118145416 missense possibly damaging 0.53
R9378:Smg1 UTSW 7 118178775 nonsense probably null
R9396:Smg1 UTSW 7 118208080 missense unknown
R9539:Smg1 UTSW 7 118145753 missense probably benign 0.03
R9549:Smg1 UTSW 7 118196031 missense unknown
R9563:Smg1 UTSW 7 118212985 missense unknown
R9564:Smg1 UTSW 7 118212985 missense unknown
R9597:Smg1 UTSW 7 118213047 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Z1176:Smg1 UTSW 7 118206887 missense unknown
Z1176:Smg1 UTSW 7 118206907 missense unknown
Z1177:Smg1 UTSW 7 118168608 missense probably null
Z1177:Smg1 UTSW 7 118213033 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGCAGTTACAAACAAGTTGC -3'
(R):5'- CAACTGAGAGTTTGTATCTCTTGC -3'

Sequencing Primer
(F):5'- TGCAGTTACAAACAAGTTGCAAAAC -3'
(R):5'- CTGAGAGTTTGTATCTCTTGCTGATG -3'
Posted On 2022-06-15