Incidental Mutation 'R9469:Rdx'
ID 715364
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51977069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: V106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: V106A

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: V106A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: V106A

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: V106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: V106A

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 A T 17: 57,183,283 (GRCm39) D8V probably benign Het
Ada T A 2: 163,574,192 (GRCm39) M155L probably benign Het
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Ahnak G A 19: 8,988,225 (GRCm39) G3170R probably damaging Het
Alb G A 5: 90,610,659 (GRCm39) D80N probably benign Het
Amph G T 13: 19,270,769 (GRCm39) G126V probably damaging Het
Anks1b A T 10: 90,733,205 (GRCm39) M994L possibly damaging Het
Atp8a2 A G 14: 60,028,668 (GRCm39) L933P probably benign Het
Bcas1 T C 2: 170,191,292 (GRCm39) D546G possibly damaging Het
Bmpr2 A C 1: 59,881,928 (GRCm39) M186L probably benign Het
Clca3a2 T C 3: 144,507,938 (GRCm39) I711V probably damaging Het
Cobll1 G A 2: 64,966,774 (GRCm39) T128I probably damaging Het
Cog4 T C 8: 111,608,804 (GRCm39) W165R unknown Het
Cyp2j5 G A 4: 96,517,731 (GRCm39) R494* probably null Het
Dnah2 G A 11: 69,321,896 (GRCm39) A3808V probably damaging Het
Dnah5 A T 15: 28,421,146 (GRCm39) T3828S probably benign Het
Dsg1c T C 18: 20,400,947 (GRCm39) I150T probably damaging Het
Ehd2 A T 7: 15,684,332 (GRCm39) I489N probably damaging Het
Fam24a C A 7: 130,938,392 (GRCm39) T94K probably damaging Het
Gata2 A G 6: 88,182,301 (GRCm39) E423G possibly damaging Het
Gm8947 A G 1: 151,069,063 (GRCm39) I299V unknown Het
Gpr161 A G 1: 165,133,896 (GRCm39) I53V possibly damaging Het
Guca2b G A 4: 119,515,817 (GRCm39) Q15* probably null Het
Hus1 A G 11: 8,948,744 (GRCm39) V219A probably benign Het
Il5 T C 11: 53,614,824 (GRCm39) W129R probably damaging Het
Ipmk A G 10: 71,201,843 (GRCm39) Y77C probably damaging Het
Kcnip3 A G 2: 127,307,322 (GRCm39) L136P probably benign Het
Klhl2 G A 8: 65,196,069 (GRCm39) A558V probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lig3 G A 11: 82,686,199 (GRCm39) C613Y probably benign Het
Lrriq1 A G 10: 103,050,761 (GRCm39) S664P probably benign Het
Megf6 A G 4: 154,335,369 (GRCm39) Y276C probably damaging Het
Mlph A G 1: 90,856,068 (GRCm39) E119G probably damaging Het
Mrpl39 T G 16: 84,517,170 (GRCm39) R316S probably damaging Het
Myo18b T C 5: 112,994,247 (GRCm39) D902G probably benign Het
Myocd A G 11: 65,087,220 (GRCm39) S236P probably benign Het
Myom1 G T 17: 71,368,122 (GRCm39) A482S possibly damaging Het
Nol4 A G 18: 23,085,318 (GRCm39) V32A probably damaging Het
Nrp2 T C 1: 62,804,030 (GRCm39) Y555H probably damaging Het
Or12d12 T C 17: 37,610,956 (GRCm39) D119G probably damaging Het
Or4d10c G A 19: 12,065,434 (GRCm39) H241Y probably benign Het
Or52l1 A T 7: 104,829,967 (GRCm39) H199Q probably damaging Het
Or8k27 C A 2: 86,275,787 (GRCm39) D180Y probably damaging Het
Papss1 A G 3: 131,288,959 (GRCm39) K175E possibly damaging Het
Pdcd5 T C 7: 35,343,827 (GRCm39) M39V probably benign Het
Plcl2 G A 17: 50,913,953 (GRCm39) D321N probably benign Het
Plxna4 G A 6: 32,494,526 (GRCm39) P30L probably benign Het
Pou2f1 G A 1: 165,740,830 (GRCm39) T113I probably benign Het
Ptpn2 T A 18: 67,808,907 (GRCm39) H303L probably benign Het
R3hdm1 T A 1: 128,106,921 (GRCm39) probably null Het
Ripk2 T C 4: 16,138,181 (GRCm39) D249G possibly damaging Het
Rnf169 A T 7: 99,575,567 (GRCm39) S343T possibly damaging Het
Rnf40 T A 7: 127,195,769 (GRCm39) L671Q probably damaging Het
Scube3 C A 17: 28,386,138 (GRCm39) S793* probably null Het
Sipa1l3 A T 7: 29,028,481 (GRCm39) M1633K possibly damaging Het
Slc16a14 A T 1: 84,900,612 (GRCm39) N124K probably benign Het
Smarcd2 G A 11: 106,163,332 (GRCm39) A68V probably benign Het
Smg1 T C 7: 117,739,774 (GRCm39) E3391G possibly damaging Het
Spata32 T C 11: 103,099,741 (GRCm39) M255V possibly damaging Het
Sstr5 T A 17: 25,710,941 (GRCm39) Q96L probably damaging Het
Tcaf3 A G 6: 42,573,828 (GRCm39) I128T probably benign Het
Tfdp1 C T 8: 13,422,965 (GRCm39) T290M probably benign Het
Ticrr C T 7: 79,344,511 (GRCm39) H1459Y probably benign Het
Tmed4 T A 11: 6,223,763 (GRCm39) Q171L probably benign Het
Tmem40 G A 6: 115,719,321 (GRCm39) S48F possibly damaging Het
Tnfaip1 A G 11: 78,419,075 (GRCm39) probably null Het
Top1mt A G 15: 75,539,742 (GRCm39) Y290H probably damaging Het
Topaz1 A T 9: 122,577,585 (GRCm39) D165V probably damaging Het
Trim44 T C 2: 102,230,651 (GRCm39) S127G unknown Het
Ubac1 G A 2: 25,897,763 (GRCm39) R286C probably damaging Het
Ube2u A G 4: 100,406,958 (GRCm39) E273G possibly damaging Het
Vmn1r213 G A 13: 23,196,101 (GRCm39) S228N probably benign Het
Vmn2r28 A T 7: 5,487,118 (GRCm39) V515E probably damaging Het
Vps13d A G 4: 144,780,691 (GRCm39) L4011P Het
Ythdc2 T C 18: 45,019,383 (GRCm39) F1384S probably damaging Het
Zfp423 T A 8: 88,509,519 (GRCm39) Y275F probably damaging Het
Zfp493 A G 13: 67,934,325 (GRCm39) K93E probably benign Het
Zfp980 G T 4: 145,427,687 (GRCm39) G139W probably benign Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAGAATGAGCTTGGGCACAC -3'
(R):5'- AAAGGCATGATTTACTTACCGC -3'

Sequencing Primer
(F):5'- AGAGTTGCTGACAGCCTCAGG -3'
(R):5'- CATGATTTACTTACCGCTGTGG -3'
Posted On 2022-06-15