Incidental Mutation 'R9469:Dnah2'
ID 715373
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms 2900022L05Rik, D330014H01Rik, Dnahc2, Dnhd3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9469 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69311635-69439934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69321896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 3808 (A3808V)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: A3802V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: A3808V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: A3808V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 A T 17: 57,183,283 (GRCm39) D8V probably benign Het
Ada T A 2: 163,574,192 (GRCm39) M155L probably benign Het
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Ahnak G A 19: 8,988,225 (GRCm39) G3170R probably damaging Het
Alb G A 5: 90,610,659 (GRCm39) D80N probably benign Het
Amph G T 13: 19,270,769 (GRCm39) G126V probably damaging Het
Anks1b A T 10: 90,733,205 (GRCm39) M994L possibly damaging Het
Atp8a2 A G 14: 60,028,668 (GRCm39) L933P probably benign Het
Bcas1 T C 2: 170,191,292 (GRCm39) D546G possibly damaging Het
Bmpr2 A C 1: 59,881,928 (GRCm39) M186L probably benign Het
Clca3a2 T C 3: 144,507,938 (GRCm39) I711V probably damaging Het
Cobll1 G A 2: 64,966,774 (GRCm39) T128I probably damaging Het
Cog4 T C 8: 111,608,804 (GRCm39) W165R unknown Het
Cyp2j5 G A 4: 96,517,731 (GRCm39) R494* probably null Het
Dnah5 A T 15: 28,421,146 (GRCm39) T3828S probably benign Het
Dsg1c T C 18: 20,400,947 (GRCm39) I150T probably damaging Het
Ehd2 A T 7: 15,684,332 (GRCm39) I489N probably damaging Het
Fam24a C A 7: 130,938,392 (GRCm39) T94K probably damaging Het
Gata2 A G 6: 88,182,301 (GRCm39) E423G possibly damaging Het
Gm8947 A G 1: 151,069,063 (GRCm39) I299V unknown Het
Gpr161 A G 1: 165,133,896 (GRCm39) I53V possibly damaging Het
Guca2b G A 4: 119,515,817 (GRCm39) Q15* probably null Het
Hus1 A G 11: 8,948,744 (GRCm39) V219A probably benign Het
Il5 T C 11: 53,614,824 (GRCm39) W129R probably damaging Het
Ipmk A G 10: 71,201,843 (GRCm39) Y77C probably damaging Het
Kcnip3 A G 2: 127,307,322 (GRCm39) L136P probably benign Het
Klhl2 G A 8: 65,196,069 (GRCm39) A558V probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lig3 G A 11: 82,686,199 (GRCm39) C613Y probably benign Het
Lrriq1 A G 10: 103,050,761 (GRCm39) S664P probably benign Het
Megf6 A G 4: 154,335,369 (GRCm39) Y276C probably damaging Het
Mlph A G 1: 90,856,068 (GRCm39) E119G probably damaging Het
Mrpl39 T G 16: 84,517,170 (GRCm39) R316S probably damaging Het
Myo18b T C 5: 112,994,247 (GRCm39) D902G probably benign Het
Myocd A G 11: 65,087,220 (GRCm39) S236P probably benign Het
Myom1 G T 17: 71,368,122 (GRCm39) A482S possibly damaging Het
Nol4 A G 18: 23,085,318 (GRCm39) V32A probably damaging Het
Nrp2 T C 1: 62,804,030 (GRCm39) Y555H probably damaging Het
Or12d12 T C 17: 37,610,956 (GRCm39) D119G probably damaging Het
Or4d10c G A 19: 12,065,434 (GRCm39) H241Y probably benign Het
Or52l1 A T 7: 104,829,967 (GRCm39) H199Q probably damaging Het
Or8k27 C A 2: 86,275,787 (GRCm39) D180Y probably damaging Het
Papss1 A G 3: 131,288,959 (GRCm39) K175E possibly damaging Het
Pdcd5 T C 7: 35,343,827 (GRCm39) M39V probably benign Het
Plcl2 G A 17: 50,913,953 (GRCm39) D321N probably benign Het
Plxna4 G A 6: 32,494,526 (GRCm39) P30L probably benign Het
Pou2f1 G A 1: 165,740,830 (GRCm39) T113I probably benign Het
Ptpn2 T A 18: 67,808,907 (GRCm39) H303L probably benign Het
R3hdm1 T A 1: 128,106,921 (GRCm39) probably null Het
Rdx T C 9: 51,977,069 (GRCm39) V106A probably damaging Het
Ripk2 T C 4: 16,138,181 (GRCm39) D249G possibly damaging Het
Rnf169 A T 7: 99,575,567 (GRCm39) S343T possibly damaging Het
Rnf40 T A 7: 127,195,769 (GRCm39) L671Q probably damaging Het
Scube3 C A 17: 28,386,138 (GRCm39) S793* probably null Het
Sipa1l3 A T 7: 29,028,481 (GRCm39) M1633K possibly damaging Het
Slc16a14 A T 1: 84,900,612 (GRCm39) N124K probably benign Het
Smarcd2 G A 11: 106,163,332 (GRCm39) A68V probably benign Het
Smg1 T C 7: 117,739,774 (GRCm39) E3391G possibly damaging Het
Spata32 T C 11: 103,099,741 (GRCm39) M255V possibly damaging Het
Sstr5 T A 17: 25,710,941 (GRCm39) Q96L probably damaging Het
Tcaf3 A G 6: 42,573,828 (GRCm39) I128T probably benign Het
Tfdp1 C T 8: 13,422,965 (GRCm39) T290M probably benign Het
Ticrr C T 7: 79,344,511 (GRCm39) H1459Y probably benign Het
Tmed4 T A 11: 6,223,763 (GRCm39) Q171L probably benign Het
Tmem40 G A 6: 115,719,321 (GRCm39) S48F possibly damaging Het
Tnfaip1 A G 11: 78,419,075 (GRCm39) probably null Het
Top1mt A G 15: 75,539,742 (GRCm39) Y290H probably damaging Het
Topaz1 A T 9: 122,577,585 (GRCm39) D165V probably damaging Het
Trim44 T C 2: 102,230,651 (GRCm39) S127G unknown Het
Ubac1 G A 2: 25,897,763 (GRCm39) R286C probably damaging Het
Ube2u A G 4: 100,406,958 (GRCm39) E273G possibly damaging Het
Vmn1r213 G A 13: 23,196,101 (GRCm39) S228N probably benign Het
Vmn2r28 A T 7: 5,487,118 (GRCm39) V515E probably damaging Het
Vps13d A G 4: 144,780,691 (GRCm39) L4011P Het
Ythdc2 T C 18: 45,019,383 (GRCm39) F1384S probably damaging Het
Zfp423 T A 8: 88,509,519 (GRCm39) Y275F probably damaging Het
Zfp493 A G 13: 67,934,325 (GRCm39) K93E probably benign Het
Zfp980 G T 4: 145,427,687 (GRCm39) G139W probably benign Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,383,498 (GRCm39) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,385,892 (GRCm39) splice site probably benign
IGL00772:Dnah2 APN 11 69,342,083 (GRCm39) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,364,176 (GRCm39) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,339,283 (GRCm39) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,368,918 (GRCm39) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,384,010 (GRCm39) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,366,432 (GRCm39) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,323,790 (GRCm39) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,365,017 (GRCm39) splice site probably benign
IGL01480:Dnah2 APN 11 69,349,197 (GRCm39) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,406,906 (GRCm39) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,321,913 (GRCm39) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,355,889 (GRCm39) splice site probably benign
IGL01667:Dnah2 APN 11 69,435,221 (GRCm39) missense probably benign
IGL01667:Dnah2 APN 11 69,411,767 (GRCm39) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,430,269 (GRCm39) missense probably benign
IGL02019:Dnah2 APN 11 69,365,111 (GRCm39) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,390,038 (GRCm39) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,313,385 (GRCm39) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,349,011 (GRCm39) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,348,949 (GRCm39) missense probably benign
IGL02381:Dnah2 APN 11 69,337,118 (GRCm39) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,343,759 (GRCm39) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,339,333 (GRCm39) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,409,240 (GRCm39) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,412,013 (GRCm39) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,327,117 (GRCm39) splice site probably benign
IGL03120:Dnah2 APN 11 69,312,674 (GRCm39) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,349,314 (GRCm39) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,350,089 (GRCm39) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,420,207 (GRCm39) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,385,949 (GRCm39) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,387,403 (GRCm39) missense probably benign 0.13
argyrios UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
Aureus UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
platinum UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,406,441 (GRCm39) splice site probably null
P0026:Dnah2 UTSW 11 69,355,773 (GRCm39) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,311,835 (GRCm39) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,326,075 (GRCm39) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,327,662 (GRCm39) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,420,357 (GRCm39) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,338,687 (GRCm39) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,390,064 (GRCm39) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,343,705 (GRCm39) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,350,114 (GRCm39) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,339,368 (GRCm39) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,350,027 (GRCm39) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,313,952 (GRCm39) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,390,020 (GRCm39) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,368,509 (GRCm39) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,312,134 (GRCm39) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,339,345 (GRCm39) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,338,645 (GRCm39) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,337,474 (GRCm39) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,390,016 (GRCm39) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,406,526 (GRCm39) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,341,876 (GRCm39) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,411,493 (GRCm39) splice site probably null
R1538:Dnah2 UTSW 11 69,368,028 (GRCm39) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,405,514 (GRCm39) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,412,024 (GRCm39) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,313,580 (GRCm39) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,364,680 (GRCm39) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,405,517 (GRCm39) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,388,715 (GRCm39) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,314,369 (GRCm39) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,366,400 (GRCm39) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,405,630 (GRCm39) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,328,712 (GRCm39) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,406,578 (GRCm39) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,355,756 (GRCm39) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,365,151 (GRCm39) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,349,184 (GRCm39) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,327,896 (GRCm39) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,415,066 (GRCm39) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,387,432 (GRCm39) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,346,742 (GRCm39) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,384,063 (GRCm39) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,349,011 (GRCm39) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,406,587 (GRCm39) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,328,047 (GRCm39) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,415,032 (GRCm39) nonsense probably null
R2517:Dnah2 UTSW 11 69,407,470 (GRCm39) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,321,304 (GRCm39) missense probably benign
R3741:Dnah2 UTSW 11 69,339,295 (GRCm39) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,383,476 (GRCm39) splice site probably null
R3872:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,320,174 (GRCm39) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,342,173 (GRCm39) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,344,929 (GRCm39) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,374,847 (GRCm39) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,368,485 (GRCm39) missense probably benign
R4515:Dnah2 UTSW 11 69,356,457 (GRCm39) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,374,193 (GRCm39) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,354,487 (GRCm39) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,356,202 (GRCm39) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,387,385 (GRCm39) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,349,768 (GRCm39) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,389,358 (GRCm39) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,368,903 (GRCm39) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,407,416 (GRCm39) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,367,514 (GRCm39) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,320,183 (GRCm39) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,348,868 (GRCm39) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,364,697 (GRCm39) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,314,031 (GRCm39) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,313,416 (GRCm39) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,354,474 (GRCm39) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,367,517 (GRCm39) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,411,973 (GRCm39) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,389,930 (GRCm39) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,430,322 (GRCm39) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,346,799 (GRCm39) nonsense probably null
R5015:Dnah2 UTSW 11 69,388,708 (GRCm39) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,338,992 (GRCm39) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,411,599 (GRCm39) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,411,759 (GRCm39) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,313,362 (GRCm39) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,326,710 (GRCm39) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,420,295 (GRCm39) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,348,819 (GRCm39) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,406,862 (GRCm39) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,312,674 (GRCm39) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,391,683 (GRCm39) missense probably benign
R5421:Dnah2 UTSW 11 69,326,462 (GRCm39) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,415,209 (GRCm39) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,364,177 (GRCm39) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,328,014 (GRCm39) nonsense probably null
R5566:Dnah2 UTSW 11 69,407,395 (GRCm39) nonsense probably null
R5587:Dnah2 UTSW 11 69,328,068 (GRCm39) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,382,370 (GRCm39) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,326,216 (GRCm39) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,321,643 (GRCm39) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,339,256 (GRCm39) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,321,974 (GRCm39) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,411,707 (GRCm39) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,391,665 (GRCm39) missense probably benign
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,406,834 (GRCm39) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,337,475 (GRCm39) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,409,185 (GRCm39) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,349,746 (GRCm39) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,349,368 (GRCm39) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,411,729 (GRCm39) nonsense probably null
R6171:Dnah2 UTSW 11 69,313,868 (GRCm39) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,348,238 (GRCm39) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,382,467 (GRCm39) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,339,053 (GRCm39) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,349,344 (GRCm39) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,430,241 (GRCm39) missense probably benign
R6478:Dnah2 UTSW 11 69,406,836 (GRCm39) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,356,212 (GRCm39) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,328,023 (GRCm39) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,314,516 (GRCm39) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,346,789 (GRCm39) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,320,297 (GRCm39) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,375,086 (GRCm39) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,312,567 (GRCm39) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,382,373 (GRCm39) nonsense probably null
R7073:Dnah2 UTSW 11 69,321,318 (GRCm39) nonsense probably null
R7111:Dnah2 UTSW 11 69,337,579 (GRCm39) splice site probably null
R7125:Dnah2 UTSW 11 69,327,008 (GRCm39) missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69,382,381 (GRCm39) missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69,439,923 (GRCm39) splice site probably null
R7214:Dnah2 UTSW 11 69,321,935 (GRCm39) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,312,222 (GRCm39) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,349,972 (GRCm39) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,321,920 (GRCm39) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,391,643 (GRCm39) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,369,623 (GRCm39) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,383,631 (GRCm39) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,389,453 (GRCm39) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,382,484 (GRCm39) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,391,622 (GRCm39) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,439,816 (GRCm39) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,326,130 (GRCm39) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,389,511 (GRCm39) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,342,144 (GRCm39) nonsense probably null
R7764:Dnah2 UTSW 11 69,348,984 (GRCm39) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,386,040 (GRCm39) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,407,419 (GRCm39) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,322,064 (GRCm39) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,409,254 (GRCm39) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,311,974 (GRCm39) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,411,660 (GRCm39) missense probably benign
R7928:Dnah2 UTSW 11 69,321,661 (GRCm39) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,408,511 (GRCm39) nonsense probably null
R7995:Dnah2 UTSW 11 69,411,563 (GRCm39) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,369,649 (GRCm39) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,411,678 (GRCm39) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,326,193 (GRCm39) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,366,399 (GRCm39) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,378,122 (GRCm39) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,320,273 (GRCm39) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,349,289 (GRCm39) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,350,104 (GRCm39) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,343,804 (GRCm39) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,405,523 (GRCm39) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,415,005 (GRCm39) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,384,087 (GRCm39) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,356,511 (GRCm39) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,382,348 (GRCm39) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,383,048 (GRCm39) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,328,754 (GRCm39) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,420,247 (GRCm39) missense probably benign
R9085:Dnah2 UTSW 11 69,320,224 (GRCm39) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,435,208 (GRCm39) missense probably benign
R9156:Dnah2 UTSW 11 69,313,687 (GRCm39) missense
R9251:Dnah2 UTSW 11 69,406,619 (GRCm39) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,368,079 (GRCm39) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,409,104 (GRCm39) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,375,155 (GRCm39) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,338,939 (GRCm39) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,384,073 (GRCm39) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,406,592 (GRCm39) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,326,990 (GRCm39) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,368,942 (GRCm39) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,364,220 (GRCm39) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,406,617 (GRCm39) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,345,208 (GRCm39) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,368,041 (GRCm39) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,344,888 (GRCm39) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,341,824 (GRCm39) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,343,763 (GRCm39) missense probably benign
RF004:Dnah2 UTSW 11 69,328,013 (GRCm39) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,374,648 (GRCm39) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,339,388 (GRCm39) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,321,619 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,312,647 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,407,349 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,407,307 (GRCm39) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,389,493 (GRCm39) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,377,880 (GRCm39) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,341,946 (GRCm39) missense probably benign
Z1177:Dnah2 UTSW 11 69,435,383 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,354,279 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCATCTCATTGCACGCATTC -3'
(R):5'- AGGGTTCTAGGCATCTTCTCTC -3'

Sequencing Primer
(F):5'- ATTCTCCCACTCACCTGCAGAC -3'
(R):5'- CCCAAGGTCCTGGATCGTGAAG -3'
Posted On 2022-06-15