Mutagenetix > Incidental Mutation

Incidental Mutation 'R9470:Zdbf2'

715397

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R9470 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63305625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1054 (N1054K)

Ref Sequence

ENSEMBL: ENSMUSP00000029025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: N1054K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: N1054K

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: N1054K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: N1054K

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,165,493	H190R	possibly damaging	Het
4930467E23Rik	T	A	8: 19,747,793	S292T	probably benign	Het
5830411N06Rik	A	G	7: 140,247,432	T18A	probably benign	Het
Adgrb2	T	A	4: 130,009,281	L558Q	probably damaging	Het
Apob	A	G	12: 7,989,219	D483G	possibly damaging	Het
Arid1a	T	C	4: 133,685,746	D994G	unknown	Het
Barx2	A	T	9: 31,858,748	Y161*	probably null	Het
Bmp7	G	T	2: 172,870,167	N421K	probably damaging	Het
Bod1l	A	T	5: 41,817,096	C2292S	probably damaging	Het
Ces1c	C	T	8: 93,104,118		probably null	Het
Clca3b	T	C	3: 144,837,695	T458A	probably damaging	Het
Cntnap5a	T	G	1: 116,446,614	V952G	probably damaging	Het
Cyp2c54	T	C	19: 40,072,444	E85G	probably damaging	Het
Dmxl1	A	G	18: 49,893,710	K1962E	possibly damaging	Het
Dnajc13	A	G	9: 104,230,720	V254A	probably benign	Het
Dysf	A	T	6: 84,113,370	I955F	possibly damaging	Het
Fam184b	A	G	5: 45,584,512	S126P	probably damaging	Het
Gapvd1	A	T	2: 34,712,268	D622E	possibly damaging	Het
Ggta1	T	C	2: 35,402,755	Y180C	probably damaging	Het
Gpr31b	A	G	17: 13,051,958	V108A	probably damaging	Het
Kcnu1	A	G	8: 25,919,632	Y861C	probably benign	Het
Mov10l1	T	C	15: 89,020,315	L799P	probably damaging	Het
Nkx1-1	G	A	5: 33,433,931	P16S	unknown	Het
Nos1	T	C	5: 117,926,495	L997P	probably damaging	Het
Noxred1	A	G	12: 87,223,055	Y301H	possibly damaging	Het
Olfr1467	A	G	19: 13,364,751	N41S	probably damaging	Het
Olfr592	G	A	7: 103,187,063	R154H	probably benign	Het
Olfr711	A	T	7: 106,972,254	I30N	probably benign	Het
Olfr738	T	C	14: 50,413,778	V78A	possibly damaging	Het
Olfr987	A	T	2: 85,331,329	S190T	probably damaging	Het
Paqr7	T	C	4: 134,507,603	V257A	probably benign	Het
Parp8	A	T	13: 116,894,756	S473R	probably benign	Het
Pcdhb14	A	T	18: 37,448,023	T61S	probably benign	Het
Pde11a	G	A	2: 75,991,268	A889V	probably benign	Het
Sertad1	T	C	7: 27,489,446	L64P	probably damaging	Het
Tmem156	C	T	5: 65,080,188	R43K	probably damaging	Het
Tmem82	T	A	4: 141,615,030	D287V	probably damaging	Het
Traf1	A	G	2: 34,943,962	F381L	probably benign	Het
Trim44	T	C	2: 102,400,306	S127G	unknown	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Ubap2	G	A	4: 41,195,434	A1068V	possibly damaging	Het
Vmn1r47	T	G	6: 90,022,795	M303R	probably null	Het
Zc3h12d	T	C	10: 7,867,557	S364P	possibly damaging	Het
Zpbp	A	T	11: 11,408,541	I242N	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TACTGCTTCTCACCCAGTGACAG -3'
(R):5'- TTGAAACCACATCGAACTCTTG -3'

Sequencing Primer
(F):5'- CCCAGTGACAGAACCTTATGTAG -3'
(R):5'- CACATCGAACTCTTGTTTAGGCAGG -3'

Posted On

2022-06-15