Incidental Mutation 'R9470:Fam184b'
ID 715414
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Name family with sequence similarity 184, member B
Synonyms 9630031F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 45529705-45639614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45584512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
AlphaFold Q0KK56
Predicted Effect probably damaging
Transcript: ENSMUST00000016023
AA Change: S126P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: S126P

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,493 H190R possibly damaging Het
4930467E23Rik T A 8: 19,747,793 S292T probably benign Het
5830411N06Rik A G 7: 140,247,432 T18A probably benign Het
Adgrb2 T A 4: 130,009,281 L558Q probably damaging Het
Apob A G 12: 7,989,219 D483G possibly damaging Het
Arid1a T C 4: 133,685,746 D994G unknown Het
Barx2 A T 9: 31,858,748 Y161* probably null Het
Bmp7 G T 2: 172,870,167 N421K probably damaging Het
Bod1l A T 5: 41,817,096 C2292S probably damaging Het
Ces1c C T 8: 93,104,118 probably null Het
Clca3b T C 3: 144,837,695 T458A probably damaging Het
Cntnap5a T G 1: 116,446,614 V952G probably damaging Het
Cyp2c54 T C 19: 40,072,444 E85G probably damaging Het
Dmxl1 A G 18: 49,893,710 K1962E possibly damaging Het
Dnajc13 A G 9: 104,230,720 V254A probably benign Het
Dysf A T 6: 84,113,370 I955F possibly damaging Het
Gapvd1 A T 2: 34,712,268 D622E possibly damaging Het
Ggta1 T C 2: 35,402,755 Y180C probably damaging Het
Gpr31b A G 17: 13,051,958 V108A probably damaging Het
Kcnu1 A G 8: 25,919,632 Y861C probably benign Het
Mov10l1 T C 15: 89,020,315 L799P probably damaging Het
Nkx1-1 G A 5: 33,433,931 P16S unknown Het
Nos1 T C 5: 117,926,495 L997P probably damaging Het
Noxred1 A G 12: 87,223,055 Y301H possibly damaging Het
Olfr1467 A G 19: 13,364,751 N41S probably damaging Het
Olfr592 G A 7: 103,187,063 R154H probably benign Het
Olfr711 A T 7: 106,972,254 I30N probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Olfr987 A T 2: 85,331,329 S190T probably damaging Het
Paqr7 T C 4: 134,507,603 V257A probably benign Het
Parp8 A T 13: 116,894,756 S473R probably benign Het
Pcdhb14 A T 18: 37,448,023 T61S probably benign Het
Pde11a G A 2: 75,991,268 A889V probably benign Het
Sertad1 T C 7: 27,489,446 L64P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tmem82 T A 4: 141,615,030 D287V probably damaging Het
Traf1 A G 2: 34,943,962 F381L probably benign Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 A1068V possibly damaging Het
Vmn1r47 T G 6: 90,022,795 M303R probably null Het
Zc3h12d T C 10: 7,867,557 S364P possibly damaging Het
Zdbf2 T A 1: 63,305,625 N1054K possibly damaging Het
Zpbp A T 11: 11,408,541 I242N probably damaging Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATTTCCGGTCTCTGGCTAGAC -3'
(R):5'- TCAGCGTGGAGTCAATACG -3'

Sequencing Primer
(F):5'- TAGACTCGGCTGTGGCATC -3'
(R):5'- GAGTCAATACGGGAAGCCCAC -3'
Posted On 2022-06-15