Incidental Mutation 'R9470:Nos1'
ID 715416
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Name nitric oxide synthase 1, neuronal
Synonyms bNOS, nNOS, 2310005C01Rik, Nos-1, NO
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 117781032-117958840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117926495 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 997 (L997P)
Ref Sequence ENSEMBL: ENSMUSP00000127432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000142742] [ENSMUST00000171055]
AlphaFold Q9Z0J4
Predicted Effect probably damaging
Transcript: ENSMUST00000086451
AA Change: L997P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: L997P

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102557
AA Change: L1031P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: L1031P

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142742
AA Change: L997P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: L997P

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171055
AA Change: L997P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: L997P

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,493 H190R possibly damaging Het
4930467E23Rik T A 8: 19,747,793 S292T probably benign Het
5830411N06Rik A G 7: 140,247,432 T18A probably benign Het
Adgrb2 T A 4: 130,009,281 L558Q probably damaging Het
Apob A G 12: 7,989,219 D483G possibly damaging Het
Arid1a T C 4: 133,685,746 D994G unknown Het
Barx2 A T 9: 31,858,748 Y161* probably null Het
Bmp7 G T 2: 172,870,167 N421K probably damaging Het
Bod1l A T 5: 41,817,096 C2292S probably damaging Het
Ces1c C T 8: 93,104,118 probably null Het
Clca3b T C 3: 144,837,695 T458A probably damaging Het
Cntnap5a T G 1: 116,446,614 V952G probably damaging Het
Cyp2c54 T C 19: 40,072,444 E85G probably damaging Het
Dmxl1 A G 18: 49,893,710 K1962E possibly damaging Het
Dnajc13 A G 9: 104,230,720 V254A probably benign Het
Dysf A T 6: 84,113,370 I955F possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Gapvd1 A T 2: 34,712,268 D622E possibly damaging Het
Ggta1 T C 2: 35,402,755 Y180C probably damaging Het
Gpr31b A G 17: 13,051,958 V108A probably damaging Het
Kcnu1 A G 8: 25,919,632 Y861C probably benign Het
Mov10l1 T C 15: 89,020,315 L799P probably damaging Het
Nkx1-1 G A 5: 33,433,931 P16S unknown Het
Noxred1 A G 12: 87,223,055 Y301H possibly damaging Het
Olfr1467 A G 19: 13,364,751 N41S probably damaging Het
Olfr592 G A 7: 103,187,063 R154H probably benign Het
Olfr711 A T 7: 106,972,254 I30N probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Olfr987 A T 2: 85,331,329 S190T probably damaging Het
Paqr7 T C 4: 134,507,603 V257A probably benign Het
Parp8 A T 13: 116,894,756 S473R probably benign Het
Pcdhb14 A T 18: 37,448,023 T61S probably benign Het
Pde11a G A 2: 75,991,268 A889V probably benign Het
Sertad1 T C 7: 27,489,446 L64P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tmem82 T A 4: 141,615,030 D287V probably damaging Het
Traf1 A G 2: 34,943,962 F381L probably benign Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 A1068V possibly damaging Het
Vmn1r47 T G 6: 90,022,795 M303R probably null Het
Zc3h12d T C 10: 7,867,557 S364P possibly damaging Het
Zdbf2 T A 1: 63,305,625 N1054K possibly damaging Het
Zpbp A T 11: 11,408,541 I242N probably damaging Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
Crumple UTSW 5 117895860 missense possibly damaging 0.95
penurious UTSW 5 117895902 missense probably damaging 0.97
spendthrift UTSW 5 117953783 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5481:Nos1 UTSW 5 117867754 missense probably benign 0.06
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7689:Nos1 UTSW 5 117897727 missense probably damaging 0.98
R7964:Nos1 UTSW 5 117900542 missense probably damaging 1.00
R8962:Nos1 UTSW 5 117879340 missense probably benign 0.05
R9147:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9148:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9149:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9246:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9248:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9249:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9254:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9255:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9256:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9283:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9320:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9321:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9326:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9327:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9331:Nos1 UTSW 5 117900524 missense possibly damaging 0.59
R9379:Nos1 UTSW 5 117879337 missense probably benign 0.44
R9432:Nos1 UTSW 5 117896806 missense probably damaging 1.00
R9581:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R9623:Nos1 UTSW 5 117949784 missense probably benign 0.00
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Z1177:Nos1 UTSW 5 117923278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCACAGGAAGCTCTGAAGAG -3'
(R):5'- GTGCTCAGATCACCCTGAAG -3'

Sequencing Primer
(F):5'- AATGACAGGCCTGGCTATTC -3'
(R):5'- AGATCACCCTGAAGCCCATTTTC -3'
Posted On 2022-06-15