Incidental Mutation 'R9470:Olfr711'
ID 715423
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor 711
Synonyms GA_x6K02T2PBJ9-9352783-9351839, MOR103-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 106969694-106975453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106972254 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 30 (I30N)
Ref Sequence ENSEMBL: ENSMUSP00000055724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably benign
Transcript: ENSMUST00000051715
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: I30N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207200
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216335
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,493 H190R possibly damaging Het
4930467E23Rik T A 8: 19,747,793 S292T probably benign Het
5830411N06Rik A G 7: 140,247,432 T18A probably benign Het
Adgrb2 T A 4: 130,009,281 L558Q probably damaging Het
Apob A G 12: 7,989,219 D483G possibly damaging Het
Arid1a T C 4: 133,685,746 D994G unknown Het
Barx2 A T 9: 31,858,748 Y161* probably null Het
Bmp7 G T 2: 172,870,167 N421K probably damaging Het
Bod1l A T 5: 41,817,096 C2292S probably damaging Het
Ces1c C T 8: 93,104,118 probably null Het
Clca3b T C 3: 144,837,695 T458A probably damaging Het
Cntnap5a T G 1: 116,446,614 V952G probably damaging Het
Cyp2c54 T C 19: 40,072,444 E85G probably damaging Het
Dmxl1 A G 18: 49,893,710 K1962E possibly damaging Het
Dnajc13 A G 9: 104,230,720 V254A probably benign Het
Dysf A T 6: 84,113,370 I955F possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Gapvd1 A T 2: 34,712,268 D622E possibly damaging Het
Ggta1 T C 2: 35,402,755 Y180C probably damaging Het
Gpr31b A G 17: 13,051,958 V108A probably damaging Het
Kcnu1 A G 8: 25,919,632 Y861C probably benign Het
Mov10l1 T C 15: 89,020,315 L799P probably damaging Het
Nkx1-1 G A 5: 33,433,931 P16S unknown Het
Nos1 T C 5: 117,926,495 L997P probably damaging Het
Noxred1 A G 12: 87,223,055 Y301H possibly damaging Het
Olfr1467 A G 19: 13,364,751 N41S probably damaging Het
Olfr592 G A 7: 103,187,063 R154H probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Olfr987 A T 2: 85,331,329 S190T probably damaging Het
Paqr7 T C 4: 134,507,603 V257A probably benign Het
Parp8 A T 13: 116,894,756 S473R probably benign Het
Pcdhb14 A T 18: 37,448,023 T61S probably benign Het
Pde11a G A 2: 75,991,268 A889V probably benign Het
Sertad1 T C 7: 27,489,446 L64P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tmem82 T A 4: 141,615,030 D287V probably damaging Het
Traf1 A G 2: 34,943,962 F381L probably benign Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 A1068V possibly damaging Het
Vmn1r47 T G 6: 90,022,795 M303R probably null Het
Zc3h12d T C 10: 7,867,557 S364P possibly damaging Het
Zdbf2 T A 1: 63,305,625 N1054K possibly damaging Het
Zpbp A T 11: 11,408,541 I242N probably damaging Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4332:Olfr711 UTSW 7 106972147 missense probably benign 0.00
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5006:Olfr711 UTSW 7 106971601 missense probably damaging 1.00
R5082:Olfr711 UTSW 7 106971664 missense probably benign 0.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6465:Olfr711 UTSW 7 106972212 missense possibly damaging 0.63
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
R9310:Olfr711 UTSW 7 106971471 missense probably damaging 1.00
R9603:Olfr711 UTSW 7 106971896 nonsense probably null
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGAGGAATCCATCTAGC -3'
(R):5'- GTGAACTTGTGATTCTGGAAAGC -3'

Sequencing Primer
(F):5'- GAATCCATCTAGCATCTTGGGGAC -3'
(R):5'- GTGAATCTTATTCACAAGAAGAGT -3'
Posted On 2022-06-15