Incidental Mutation 'R9470:Or6b6'
ID 715423
Institutional Source Beutler Lab
Gene Symbol Or6b6
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor family 6 subfamily B member 6
Synonyms MOR103-4, Olfr711, GA_x6K02T2PBJ9-9352783-9351839
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 106570575-106574658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106571461 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 30 (I30N)
Ref Sequence ENSEMBL: ENSMUSP00000055724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably benign
Transcript: ENSMUST00000051715
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: I30N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207200
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216335
AA Change: I30N

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T A 4: 129,903,074 (GRCm39) L558Q probably damaging Het
Apob A G 12: 8,039,219 (GRCm39) D483G possibly damaging Het
Arid1a T C 4: 133,413,057 (GRCm39) D994G unknown Het
Barx2 A T 9: 31,770,044 (GRCm39) Y161* probably null Het
Bmp7 G T 2: 172,711,960 (GRCm39) N421K probably damaging Het
Bod1l A T 5: 41,974,439 (GRCm39) C2292S probably damaging Het
Ces1c C T 8: 93,830,746 (GRCm39) probably null Het
Clca3b T C 3: 144,543,456 (GRCm39) T458A probably damaging Het
Cntnap5a T G 1: 116,374,344 (GRCm39) V952G probably damaging Het
Cyp2c54 T C 19: 40,060,888 (GRCm39) E85G probably damaging Het
Dmxl1 A G 18: 50,026,777 (GRCm39) K1962E possibly damaging Het
Dnajc13 A G 9: 104,107,919 (GRCm39) V254A probably benign Het
Dysf A T 6: 84,090,352 (GRCm39) I955F possibly damaging Het
Fam184b A G 5: 45,741,854 (GRCm39) S126P probably damaging Het
Gapvd1 A T 2: 34,602,280 (GRCm39) D622E possibly damaging Het
Ggta1 T C 2: 35,292,767 (GRCm39) Y180C probably damaging Het
Gpr31b A G 17: 13,270,845 (GRCm39) V108A probably damaging Het
Kcnu1 A G 8: 26,409,660 (GRCm39) Y861C probably benign Het
Mov10l1 T C 15: 88,904,518 (GRCm39) L799P probably damaging Het
Nkx1-1 G A 5: 33,591,275 (GRCm39) P16S unknown Het
Nos1 T C 5: 118,064,560 (GRCm39) L997P probably damaging Het
Noxred1 A G 12: 87,269,829 (GRCm39) Y301H possibly damaging Het
Nup50l T C 6: 96,142,474 (GRCm39) H190R possibly damaging Het
Or11g1 T C 14: 50,651,235 (GRCm39) V78A possibly damaging Het
Or52j3 G A 7: 102,836,270 (GRCm39) R154H probably benign Het
Or5ak4 A T 2: 85,161,673 (GRCm39) S190T probably damaging Het
Or5b113 A G 19: 13,342,115 (GRCm39) N41S probably damaging Het
Paqr7 T C 4: 134,234,914 (GRCm39) V257A probably benign Het
Parp8 A T 13: 117,031,292 (GRCm39) S473R probably benign Het
Pcdhb14 A T 18: 37,581,076 (GRCm39) T61S probably benign Het
Pde11a G A 2: 75,821,612 (GRCm39) A889V probably benign Het
Potefam3e T A 8: 19,797,809 (GRCm39) S292T probably benign Het
Scart2 A G 7: 139,827,345 (GRCm39) T18A probably benign Het
Sertad1 T C 7: 27,188,871 (GRCm39) L64P probably damaging Het
Tmem156 C T 5: 65,237,531 (GRCm39) R43K probably damaging Het
Tmem82 T A 4: 141,342,341 (GRCm39) D287V probably damaging Het
Traf1 A G 2: 34,833,974 (GRCm39) F381L probably benign Het
Trim44 T C 2: 102,230,651 (GRCm39) S127G unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 (GRCm39) A1068V possibly damaging Het
Vmn1r47 T G 6: 89,999,777 (GRCm39) M303R probably null Het
Zc3h12d T C 10: 7,743,321 (GRCm39) S364P possibly damaging Het
Zdbf2 T A 1: 63,344,784 (GRCm39) N1054K possibly damaging Het
Zpbp A T 11: 11,358,541 (GRCm39) I242N probably damaging Het
Other mutations in Or6b6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Or6b6 APN 7 106,570,756 (GRCm39) missense possibly damaging 0.51
R0087:Or6b6 UTSW 7 106,571,323 (GRCm39) missense probably benign 0.01
R0580:Or6b6 UTSW 7 106,571,447 (GRCm39) missense probably damaging 1.00
R1375:Or6b6 UTSW 7 106,571,305 (GRCm39) missense probably damaging 1.00
R1538:Or6b6 UTSW 7 106,571,190 (GRCm39) nonsense probably null
R1875:Or6b6 UTSW 7 106,571,389 (GRCm39) missense possibly damaging 0.86
R2156:Or6b6 UTSW 7 106,570,775 (GRCm39) missense probably damaging 1.00
R4290:Or6b6 UTSW 7 106,570,918 (GRCm39) missense probably damaging 0.97
R4332:Or6b6 UTSW 7 106,571,354 (GRCm39) missense probably benign 0.00
R4400:Or6b6 UTSW 7 106,571,209 (GRCm39) missense probably damaging 1.00
R4688:Or6b6 UTSW 7 106,571,068 (GRCm39) missense probably benign 0.02
R4868:Or6b6 UTSW 7 106,570,974 (GRCm39) missense probably benign
R4970:Or6b6 UTSW 7 106,570,778 (GRCm39) missense probably benign 0.35
R5006:Or6b6 UTSW 7 106,570,808 (GRCm39) missense probably damaging 1.00
R5082:Or6b6 UTSW 7 106,570,871 (GRCm39) missense probably benign 0.00
R5121:Or6b6 UTSW 7 106,571,438 (GRCm39) missense probably benign
R6465:Or6b6 UTSW 7 106,571,419 (GRCm39) missense possibly damaging 0.63
R6541:Or6b6 UTSW 7 106,571,410 (GRCm39) missense probably benign 0.20
R7419:Or6b6 UTSW 7 106,571,353 (GRCm39) missense probably benign 0.01
R8048:Or6b6 UTSW 7 106,571,671 (GRCm39) start gained probably benign
R9310:Or6b6 UTSW 7 106,570,678 (GRCm39) missense probably damaging 1.00
R9603:Or6b6 UTSW 7 106,571,103 (GRCm39) nonsense probably null
Z1177:Or6b6 UTSW 7 106,571,122 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGAGGAATCCATCTAGC -3'
(R):5'- GTGAACTTGTGATTCTGGAAAGC -3'

Sequencing Primer
(F):5'- GAATCCATCTAGCATCTTGGGGAC -3'
(R):5'- GTGAATCTTATTCACAAGAAGAGT -3'
Posted On 2022-06-15