Incidental Mutation 'R9470:5830411N06Rik'
ID 715424
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9470 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140247432 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably benign
Transcript: ENSMUST00000093984
AA Change: T18A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: T18A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164583
AA Change: T18A

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: T18A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,493 H190R possibly damaging Het
4930467E23Rik T A 8: 19,747,793 S292T probably benign Het
Adgrb2 T A 4: 130,009,281 L558Q probably damaging Het
Apob A G 12: 7,989,219 D483G possibly damaging Het
Arid1a T C 4: 133,685,746 D994G unknown Het
Barx2 A T 9: 31,858,748 Y161* probably null Het
Bmp7 G T 2: 172,870,167 N421K probably damaging Het
Bod1l A T 5: 41,817,096 C2292S probably damaging Het
Ces1c C T 8: 93,104,118 probably null Het
Clca3b T C 3: 144,837,695 T458A probably damaging Het
Cntnap5a T G 1: 116,446,614 V952G probably damaging Het
Cyp2c54 T C 19: 40,072,444 E85G probably damaging Het
Dmxl1 A G 18: 49,893,710 K1962E possibly damaging Het
Dnajc13 A G 9: 104,230,720 V254A probably benign Het
Dysf A T 6: 84,113,370 I955F possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Gapvd1 A T 2: 34,712,268 D622E possibly damaging Het
Ggta1 T C 2: 35,402,755 Y180C probably damaging Het
Gpr31b A G 17: 13,051,958 V108A probably damaging Het
Kcnu1 A G 8: 25,919,632 Y861C probably benign Het
Mov10l1 T C 15: 89,020,315 L799P probably damaging Het
Nkx1-1 G A 5: 33,433,931 P16S unknown Het
Nos1 T C 5: 117,926,495 L997P probably damaging Het
Noxred1 A G 12: 87,223,055 Y301H possibly damaging Het
Olfr1467 A G 19: 13,364,751 N41S probably damaging Het
Olfr592 G A 7: 103,187,063 R154H probably benign Het
Olfr711 A T 7: 106,972,254 I30N probably benign Het
Olfr738 T C 14: 50,413,778 V78A possibly damaging Het
Olfr987 A T 2: 85,331,329 S190T probably damaging Het
Paqr7 T C 4: 134,507,603 V257A probably benign Het
Parp8 A T 13: 116,894,756 S473R probably benign Het
Pcdhb14 A T 18: 37,448,023 T61S probably benign Het
Pde11a G A 2: 75,991,268 A889V probably benign Het
Sertad1 T C 7: 27,489,446 L64P probably damaging Het
Tmem156 C T 5: 65,080,188 R43K probably damaging Het
Tmem82 T A 4: 141,615,030 D287V probably damaging Het
Traf1 A G 2: 34,943,962 F381L probably benign Het
Trim44 T C 2: 102,400,306 S127G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubap2 G A 4: 41,195,434 A1068V possibly damaging Het
Vmn1r47 T G 6: 90,022,795 M303R probably null Het
Zc3h12d T C 10: 7,867,557 S364P possibly damaging Het
Zdbf2 T A 1: 63,305,625 N1054K possibly damaging Het
Zpbp A T 11: 11,408,541 I242N probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCCTATGGTGCTGAAG -3'
(R):5'- CTCAGTCGTAAATACTCTGCATTG -3'

Sequencing Primer
(F):5'- CCTATGGTGCTGAAGGGCTC -3'
(R):5'- CAGAATCCAAATGGTTGCTTTGATG -3'
Posted On 2022-06-15